ID: 949743682

View in Genome Browser
Species Human (GRCh38)
Location 3:7264368-7264390
Sequence AACTGCTTGGAGAAGTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 2, 1: 2, 2: 65, 3: 130, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949743682_949743690 12 Left 949743682 3:7264368-7264390 CCCTACCACTTCTCCAAGCAGTT 0: 2
1: 2
2: 65
3: 130
4: 259
Right 949743690 3:7264403-7264425 TGAAGTGTCTGTGGTAGTCATGG 0: 1
1: 0
2: 11
3: 53
4: 376
949743682_949743693 29 Left 949743682 3:7264368-7264390 CCCTACCACTTCTCCAAGCAGTT 0: 2
1: 2
2: 65
3: 130
4: 259
Right 949743693 3:7264420-7264442 TCATGGGGTCTCCTCCTGCCAGG 0: 2
1: 9
2: 36
3: 101
4: 313
949743682_949743691 13 Left 949743682 3:7264368-7264390 CCCTACCACTTCTCCAAGCAGTT 0: 2
1: 2
2: 65
3: 130
4: 259
Right 949743691 3:7264404-7264426 GAAGTGTCTGTGGTAGTCATGGG 0: 1
1: 0
2: 2
3: 27
4: 236
949743682_949743688 3 Left 949743682 3:7264368-7264390 CCCTACCACTTCTCCAAGCAGTT 0: 2
1: 2
2: 65
3: 130
4: 259
Right 949743688 3:7264394-7264416 CCTGCCAACTGAAGTGTCTGTGG 0: 1
1: 14
2: 32
3: 88
4: 337
949743682_949743692 14 Left 949743682 3:7264368-7264390 CCCTACCACTTCTCCAAGCAGTT 0: 2
1: 2
2: 65
3: 130
4: 259
Right 949743692 3:7264405-7264427 AAGTGTCTGTGGTAGTCATGGGG 0: 1
1: 3
2: 16
3: 60
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949743682 Original CRISPR AACTGCTTGGAGAAGTGGTA GGG (reversed) Intronic
903030723 1:20462477-20462499 AACTGCTGGGAGAAGAGATTTGG - Intergenic
905620089 1:39437711-39437733 CTCTTCTTGGAGAAGTGTTAGGG - Intronic
906459976 1:46029594-46029616 CACTACTTGGAAAAGGGGTAAGG + Intronic
907400142 1:54220211-54220233 GACTGCTTGGAGAGGAGGGAGGG + Intronic
907869391 1:58429657-58429679 GACTGCATGGAGTAGTGGAAAGG + Intronic
908667527 1:66509803-66509825 AGCTGCTTAGAGAAGTGGGAGGG + Intergenic
908935837 1:69374354-69374376 AGCTACTTAGGGAAGTGGTAGGG - Intergenic
909024535 1:70467691-70467713 AGCTGCTTAGAGAAGTGATGGGG + Intergenic
909049773 1:70753551-70753573 AGCTGCTTAGAGAAGTGGTGGGG - Intergenic
909673150 1:78211471-78211493 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
909761477 1:79293139-79293161 AATTACTTAGAGATGTGGTAAGG - Intergenic
910610261 1:89133833-89133855 AGCTGCTTGGAGACTTGGTAGGG + Intronic
910820277 1:91338190-91338212 AACTGCCTGGAGAAATGGCAGGG + Intronic
911182938 1:94877104-94877126 CACAGCTTGGAGAAGTGGCAAGG - Intronic
912167860 1:107061333-107061355 AACTGTTGGGAAAATTGGTATGG - Intergenic
912915801 1:113812965-113812987 AACTGCTTGGAGTCCTGGTGAGG + Intergenic
912921382 1:113870638-113870660 TTTTGCTTGGAGAAGTGGAATGG - Intronic
913349495 1:117842279-117842301 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
915774322 1:158466060-158466082 AGCTGGTTGGAGGAGTGGAAGGG - Exonic
917567621 1:176229468-176229490 AGCTGCTTAGAGAAGGGGTAGGG + Intergenic
917895587 1:179484225-179484247 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
919207547 1:194437095-194437117 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
919209347 1:194458170-194458192 AACTGCTTGTGGAAGTGTTGAGG + Intergenic
920430222 1:205914195-205914217 AACTGCATGCAGATGTGGAAAGG - Exonic
921104103 1:211959119-211959141 GGCTGCTTAGAGAAGTGTTAGGG + Intronic
921800816 1:219399948-219399970 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
923855204 1:237838719-237838741 AGCTGCTTAGAGAAGTGGTAAGG + Intergenic
924269178 1:242315013-242315035 AACTGCTTGGCCAAATGGTGTGG - Intronic
924952602 1:248898230-248898252 ACCTGCTTGAAGAAGTAGTCTGG - Intergenic
1063006031 10:1971428-1971450 TTCTGCATGGAGACGTGGTATGG + Intergenic
1063819535 10:9819099-9819121 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1064913357 10:20427682-20427704 AACTGCTTGAAGGGGTGGCAGGG - Intergenic
1065428966 10:25634164-25634186 AACTGCTTTCTGAAGGGGTAAGG - Intergenic
1065902949 10:30224435-30224457 AACTGCCTGGAGAAGTCAAAAGG - Intergenic
1066179076 10:32942303-32942325 AACTCCTAGGAAAAGAGGTACGG + Intronic
1067804202 10:49381968-49381990 ACGGGCTTGGAGAAGTGGTTGGG + Intronic
1068261893 10:54594201-54594223 AGCTACTTAGTGAAGTGGTAGGG + Intronic
1068463034 10:57351563-57351585 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1069334175 10:67328484-67328506 AGCTGCTTAGAGAAGGGTTAGGG - Intronic
1071272125 10:84017568-84017590 CACAGCTTTGAGAAGTGGGAGGG + Intergenic
1071454634 10:85836577-85836599 AGCTGATTAGAGAAGTGGTGGGG + Intronic
1071736139 10:88303194-88303216 AGCTGCTTAGAGAAGAGGTAGGG + Intronic
1072929800 10:99652300-99652322 GACTGATTGGAGAGGTGGAAGGG + Intergenic
1073204408 10:101761326-101761348 ACCTGCTTGGATGAGTGGAAGGG + Intergenic
1074709119 10:116162417-116162439 TACCGCTTGGAGAGGTGGTCGGG - Intronic
1075003215 10:118812917-118812939 AACTGCTTGTGGAACGGGTATGG - Intergenic
1078694865 11:13620806-13620828 AGCTGCTTGAAGAAGTGGCAGGG - Intergenic
1079082605 11:17424449-17424471 CACAGCTTGGAGAAGAGGTGGGG + Intronic
1080224915 11:29949835-29949857 ACCTGCTTAGAGAAGTGGTAGGG + Intergenic
1080256331 11:30295110-30295132 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
1081379244 11:42394719-42394741 AACTGCTTATAGAGGTAGTAGGG + Intergenic
1082193487 11:49274248-49274270 AGCTGCTTGGAGAAGTGTCAGGG - Intergenic
1082665438 11:55970810-55970832 AGATGCTTAGACAAGTGGTAGGG + Intergenic
1082894628 11:58176875-58176897 CACTGCTTGGAGAAATCCTAAGG - Intronic
1083078100 11:60062534-60062556 AAGTGCTTTTGGAAGTGGTATGG - Exonic
1085856537 11:80181885-80181907 AGCTACTCAGAGAAGTGGTAGGG - Intergenic
1086167234 11:83793570-83793592 AACTGCATGGAAAAATGGGAAGG + Intronic
1086932485 11:92707536-92707558 ACCTTCTTGGAGAAGAGGTTAGG + Intronic
1087309358 11:96521883-96521905 ATCTGCTGAGAGAAGTGGTAGGG - Intergenic
1087377900 11:97367541-97367563 AGATGCTTAGAGAAGTGGTAGGG + Intergenic
1087561580 11:99796839-99796861 AGCTGCTTAGAGATGTAGTAGGG - Intronic
1087619822 11:100528612-100528634 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1088806628 11:113358711-113358733 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1089770859 11:120801955-120801977 AACTTCTGGGAGCAGTGTTAAGG - Intronic
1090105693 11:123851949-123851971 AGCTTCTTAGAGAGGTGGTAGGG - Intergenic
1090684430 11:129100090-129100112 AGCTTCTTAGAGAAGTGGTAGGG + Intronic
1090740344 11:129654257-129654279 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1090856282 11:130611725-130611747 AACTGCTTTGATAGGTGGGAAGG + Intergenic
1091889492 12:4041837-4041859 AAATGCTCTGAGAAGTGGAAGGG + Intergenic
1093481883 12:19612508-19612530 AGCTGTTTGGAGAGGTGGCAGGG - Intronic
1093490618 12:19700541-19700563 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
1093496443 12:19763263-19763285 AACTGCCTAGAGAGTTGGTAGGG + Intergenic
1093542075 12:20299140-20299162 AGCTGCTTGGAGAGCTGGCAGGG - Intergenic
1093655272 12:21687570-21687592 AGCTACTTGGAGAGGTGGCAGGG + Intronic
1094656012 12:32419926-32419948 CACTGCTGGGAGAAGGGGGAGGG + Intronic
1098417209 12:70247857-70247879 AACAGATTGGAAAAGTGGTGGGG + Intronic
1098678493 12:73321232-73321254 AGCTGCTTATAGAAGTGATAAGG + Intergenic
1099732863 12:86526808-86526830 AGCTGCTTAGAGAAGTTGTAGGG - Intronic
1100005513 12:89890741-89890763 AACTGGTTGGAAAGCTGGTAAGG + Intergenic
1100181921 12:92095134-92095156 AACTGCCTGGAGAAATGCAAGGG + Intronic
1101471335 12:104999678-104999700 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1101502603 12:105318078-105318100 AATTGCTTGGAAAAGAGGGAGGG - Intronic
1101509520 12:105380151-105380173 AACTGGTTGGAGAATTGTTGGGG - Intronic
1103587794 12:121969015-121969037 AGGGGCTTGGAGAAGTGGTCAGG - Intronic
1104609085 12:130213717-130213739 ACCTGCTTGGAGAAGGGCTGGGG + Intergenic
1105396862 13:20044223-20044245 AGCTGCTTAAAGAAGTTGTAGGG - Intronic
1107205881 13:37787682-37787704 AATTTCTTTGAGAAGTTGTAGGG + Intronic
1107996280 13:45864392-45864414 CACTGTTTGGAGACGTGGAAGGG - Intergenic
1109326211 13:60870410-60870432 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG + Intergenic
1109529815 13:63627363-63627385 AACTGCTTGCAGAAGAAGCAAGG + Intergenic
1109667138 13:65553778-65553800 AGCTGCTTAAAGAAGTGGTAGGG - Intergenic
1110371521 13:74746479-74746501 AACTGCTTCAGGAAGTGGCAAGG - Intergenic
1111113706 13:83749419-83749441 AGCTGCTAAGAGAAGTGGTGGGG + Intergenic
1113542889 13:111122716-111122738 ACCTGCCTGAAGAGGTGGTATGG - Intronic
1114408487 14:22478505-22478527 AACTGCTTGATGATGTTGTAAGG - Intergenic
1114657632 14:24325602-24325624 AACTCCTTGGAGAACTGGTAGGG - Intronic
1115883370 14:37945389-37945411 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
1116243481 14:42378740-42378762 AGTTGCTTAGAGAAGTGGTAGGG + Intergenic
1116282747 14:42929201-42929223 AGTTGGTTAGAGAAGTGGTAGGG - Intergenic
1116336596 14:43665497-43665519 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1117638663 14:57774388-57774410 AGCTTCTTAGAGAAGTGGTAGGG + Intronic
1118114702 14:62762088-62762110 TGCTGCTTGGAGAGGTGGCAGGG + Intronic
1118416077 14:65538182-65538204 AGCTGCTTCGAGAAGTGGTAAGG - Intronic
1118646639 14:67846911-67846933 AGGTGCTTAGAGAGGTGGTAGGG - Intronic
1120294969 14:82628421-82628443 AACTTCTTGGAGAAGATGGATGG - Intergenic
1120723968 14:87917023-87917045 AGCTACTCAGAGAAGTGGTAGGG - Intronic
1123208024 14:106732456-106732478 AACTCCTTGGTGAAGAGGAAGGG + Intergenic
1124077679 15:26461584-26461606 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1125239492 15:37557972-37557994 AGCTGCTTAGAGAAGTGGAAGGG + Intergenic
1126227716 15:46290248-46290270 AGCTGCTGAGAGAGGTGGTAGGG - Intergenic
1126506267 15:49407192-49407214 AGCTGCTTAGAAAAGTGGTAGGG - Intronic
1127098210 15:55535018-55535040 AGCTGCTCAGAGAACTGGTAGGG + Intergenic
1129201738 15:74006564-74006586 AAATGTTTAGAGAAGTGGCAGGG + Intronic
1129304703 15:74651074-74651096 TACTGCTTAGTAAAGTGGTAAGG - Intronic
1129572246 15:76700336-76700358 AATTGCTTGGAGAGGTGGCAGGG - Intronic
1129931070 15:79411744-79411766 AGTTGCTTGGAGAAGTGGTAGGG + Intronic
1131711733 15:95062839-95062861 AGATGCTTGAAGAAGTGGCAGGG - Intergenic
1132435531 15:101798535-101798557 AACTGTCTGGAGATGGGGTAGGG + Intergenic
1135800480 16:25489416-25489438 AGCTGCTTAAAGAGGTGGTAGGG - Intergenic
1138976553 16:62214626-62214648 GGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1139099055 16:63743833-63743855 AGCTGCTTAGAGAGGTGGCAAGG + Intergenic
1139121975 16:64031422-64031444 AACTTCTTGGATTTGTGGTATGG + Intergenic
1141025423 16:80541716-80541738 AACTGGGTGGAGAAATGGAAAGG + Intronic
1141070976 16:80954428-80954450 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1142303804 16:89274531-89274553 AACTGCATGGACAAGTGTTACGG + Intronic
1142388817 16:89784701-89784723 AACGGCTTGGGGAAGGGGAAGGG + Intronic
1146233135 17:31131235-31131257 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1146593125 17:34146047-34146069 AACAGCTGGGAGAATGGGTATGG + Intronic
1149131031 17:53302763-53302785 AGCTGCTTGGAGAGTTGGCAGGG + Intergenic
1151141098 17:71992979-71993001 AGCAGCTTGGAGGAGTGGCAGGG + Intergenic
1152799957 17:82326259-82326281 AACTGCTTTGGGATGTGGTTTGG + Intronic
1153094222 18:1382854-1382876 AGCTGCTTAGAATAGTGGTAGGG + Intergenic
1153399340 18:4666502-4666524 ACCTTCTTAGAGAAGTGGTGAGG + Intergenic
1153410637 18:4789067-4789089 AGCTGCTAAGAGAAGTGGTAGGG + Intergenic
1154147568 18:11878955-11878977 AACTGGTTGGAGGAGTGGGGAGG + Intronic
1154400754 18:14034608-14034630 ACCTGCTTAGAGAGGTGGTAGGG + Intergenic
1158366628 18:56744352-56744374 AACTTCTGGGAGAAATGGGAAGG - Intronic
1160250457 18:77199298-77199320 AACTCCAGGGAGAAGTGGAAAGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166909171 19:46138975-46138997 AGCTGCTTGGAGAGTTGGCAGGG - Intergenic
1168605834 19:57759328-57759350 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
925371083 2:3346038-3346060 ACATGCTGGGAGAAGTGGTGTGG - Intronic
925553858 2:5106784-5106806 TGCTGCTTAGTGAAGTGGTAGGG - Intergenic
926823754 2:16881917-16881939 AAGAGATTGGAGAAGTGGTGTGG + Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
928490418 2:31777852-31777874 AGCTGCCCAGAGAAGTGGTAGGG + Intergenic
928728739 2:34206432-34206454 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG + Intergenic
931183126 2:59923507-59923529 AACTGCCTGGGGAGGTGGTGAGG - Intergenic
931489275 2:62726208-62726230 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
931890142 2:66662260-66662282 AGCTGCTTACAGAAGTGGTAGGG - Intergenic
932539608 2:72638702-72638724 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
932630859 2:73342070-73342092 AATTGGTTGGAGAAGTGGTACGG + Intergenic
932698028 2:73973258-73973280 AACTGCTTGCAGGAGTGATCAGG - Intergenic
933084073 2:78032791-78032813 ATGTGAATGGAGAAGTGGTAAGG - Intergenic
934863845 2:97788380-97788402 GACTGCTGGGGGAAGTGGTAGGG - Intronic
935449168 2:103189729-103189751 AACTGTTTACAGAAGTTGTAGGG + Intergenic
935847939 2:107187278-107187300 AGATGCTTAGAGAAGTGGCAAGG + Intergenic
936909155 2:117572475-117572497 AACTGCTTAAAGAAGTGGTGGGG - Intergenic
937051479 2:118894924-118894946 AACTGCATGGAGAAGAGGGCTGG - Intergenic
937195853 2:120155999-120156021 AGCTGCTTAGAGAAGTGGTGGGG + Intronic
937977604 2:127591282-127591304 AACTGCTGGGAGAAGTAGCTGGG + Intronic
938595727 2:132785338-132785360 AACTGCTTGGAGCAATGCTAAGG + Exonic
942324951 2:174768716-174768738 AACTGCTAGGAGATGAGGTCAGG + Intergenic
942405166 2:175646418-175646440 AGCTGCTCAGAGAAGTGGTAGGG + Intergenic
943092442 2:183390600-183390622 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
943093866 2:183405205-183405227 AGCTGCTTAGAGATGTGGTAGGG - Intergenic
943153131 2:184138813-184138835 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
944089003 2:195883584-195883606 AACACCTTGGTGAAGTGGGAAGG - Intronic
944621713 2:201522675-201522697 AGCTGCTTGGAGAGTTGGCAGGG + Intronic
945761494 2:213920877-213920899 AGCTGCTTAGAGAATTGGTAGGG - Intronic
948354156 2:237364175-237364197 ACCTGCTTGGAGCTGTGGGATGG - Intronic
948731996 2:239971064-239971086 AACTGCCTAGAGCAGTAGTAGGG - Intronic
1169462419 20:5807250-5807272 AACTGCTTTGAAAACTGGGATGG - Intronic
1171053520 20:21883600-21883622 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1173343202 20:42173371-42173393 ATCTGGTTGGAGAAGAGGTAAGG - Intronic
1173693986 20:44991548-44991570 AACTGCTTTGAGAAATAGCAGGG - Intronic
1175349990 20:58310455-58310477 AACTCTTTGGACAAGTGGCAGGG - Intronic
1176345903 21:5746396-5746418 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176352717 21:5866980-5867002 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176498924 21:7578059-7578081 AGCTGCTTAGAGAAGTGACAGGG + Intergenic
1176540224 21:8144466-8144488 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176559175 21:8327511-8327533 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1177043956 21:16146424-16146446 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1177244164 21:18501095-18501117 ATCTGGCTGGAGAAGGGGTAAGG + Intergenic
1177507882 21:22041094-22041116 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1179123476 21:38570249-38570271 AGTTGCTTTGAGAAGTGGTTGGG - Intronic
1180192553 21:46173015-46173037 AGCTGCTTAGAGAAGTGATGGGG + Intronic
1182430708 22:30297369-30297391 AACTGCTAGGAGAATTTGTGGGG - Intronic
1203245167 22_KI270733v1_random:60833-60855 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
949273120 3:2244046-2244068 ATCTACTTGGAGTTGTGGTATGG - Intronic
949743682 3:7264368-7264390 AACTGCTTGGAGAAGTGGTAGGG - Intronic
950849025 3:16044225-16044247 AGCTGCTTGGAGAGGTGGCAGGG - Intergenic
951258747 3:20481977-20481999 AGCTGCTTAGAGAAGTGGTGGGG + Intergenic
953816500 3:46162754-46162776 AACTGCTTAAAGAAGTAGTCTGG + Intergenic
954509051 3:51105997-51106019 AGCTGCTTAGAGAAGTAGTAGGG + Intronic
954522713 3:51243264-51243286 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
955618136 3:60831076-60831098 AACTAGTTGGGGAAGTGGTATGG - Intronic
956378871 3:68644930-68644952 AGCTGCTTGGAGAGGTGGCAGGG - Intergenic
957673939 3:83342082-83342104 AACTATTTGGATAAGGGGTAAGG - Intergenic
958464586 3:94442490-94442512 AGCTGCTTAGAGAAGTGGTGGGG + Intergenic
959041058 3:101423905-101423927 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
959167969 3:102804447-102804469 AACTGATTGGATAAGTGAAATGG + Intergenic
959174306 3:102886696-102886718 GACTGCTTAAAGAAGTGGTGGGG - Intergenic
959295585 3:104530820-104530842 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
959433547 3:106284784-106284806 ATCTGCTTAGAGAAGTGGTAGGG + Intergenic
959440047 3:106362909-106362931 AGCTACTTAGAGAGGTGGTAGGG - Intergenic
959806665 3:110562502-110562524 AACTGCTTGGAGCTGGGGGAAGG + Intergenic
960015784 3:112885975-112885997 AGCTGCTTGGAGAATTGGCAGGG - Intergenic
960258235 3:115533729-115533751 AACTGCTTAGAGAAGTAGCAGGG - Intergenic
961933200 3:130555168-130555190 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
961987968 3:131157890-131157912 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
962464981 3:135649541-135649563 AGCTGGTTAGAGAAGTGGTAGGG - Intergenic
962655818 3:137542943-137542965 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
963914188 3:150842437-150842459 AGCTGCTTAGAGAAATGATAGGG - Intergenic
963928378 3:150976074-150976096 AGCTGCATGGAGAAGAGGTGAGG - Intergenic
964624911 3:158749481-158749503 AAGTGCTTGAACACGTGGTATGG - Intronic
965241789 3:166210618-166210640 AACTGCTTAGAAAAGTGGCTTGG - Intergenic
965805126 3:172534071-172534093 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
966489858 3:180516249-180516271 AACTCCTTAGAGAAGTGGTGAGG + Intergenic
966714362 3:183000729-183000751 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
967523641 3:190466490-190466512 AGCTACTTAGAGAAGTGGTAAGG + Intergenic
967651896 3:191996053-191996075 AACTGCTTAGGTAGGTGGTATGG + Intergenic
967668333 3:192201492-192201514 TACTGCATGGAGATGTGGTGAGG - Intronic
968610703 4:1555689-1555711 CGCTGCTTAGAGAAGTGGGAAGG - Intergenic
969556736 4:7916647-7916669 AACTGCCTGGAGGTGTGGTCTGG - Intronic
969836986 4:9850280-9850302 AACTGCTTAGACAGGTGGCAGGG + Intronic
970101125 4:12524083-12524105 AGCTCCTTAGAGAAGTGGTAGGG + Intergenic
972123895 4:35740117-35740139 AGCTGCTTAGAGAAGTAGCAGGG + Intergenic
972270189 4:37503100-37503122 AGCTGCTAAGAGAAGTGGTAGGG - Intronic
973287120 4:48431184-48431206 AACTGGTAAGAGAAGAGGTATGG - Intergenic
974240413 4:59238623-59238645 AGTTGCTTAGAGAAGTGGTAGGG - Intergenic
974581998 4:63815024-63815046 AGCTGCTCAGAGAAGTGGTGGGG - Intergenic
974603846 4:64123081-64123103 ATCTGCTTAGAGAAGTGGTAGGG - Intergenic
974650574 4:64748864-64748886 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
975361677 4:73477638-73477660 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
975403674 4:73965577-73965599 AGCTGCTTAGGGAAGTGGTAGGG - Intergenic
975909154 4:79247877-79247899 AGCAGCTTAGAGAGGTGGTAGGG + Intronic
977216237 4:94287123-94287145 AACTTCTAGGAAAAGTGGTAAGG - Intronic
977482158 4:97592862-97592884 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
977518778 4:98055600-98055622 AGCTGCTTAGAGAAGTGGTGGGG + Intronic
977696400 4:99971302-99971324 AGCTGCTTAGATAAGTGGTTGGG + Intergenic
978596107 4:110379210-110379232 AGCTGCTTAGAGAAATGGTAGGG + Intronic
978923606 4:114216828-114216850 TGCTGCTTAGATAAGTGGTATGG + Intergenic
979010084 4:115355809-115355831 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
979158656 4:117430002-117430024 AGCTGTTTAGAGAAGTGGTAGGG - Intergenic
979768924 4:124498380-124498402 AAGTGCTTGGTGAAGTGGGTGGG + Intergenic
980322329 4:131294057-131294079 AGCTGCTTGGAGAGTTGGCAGGG - Intergenic
981072546 4:140559019-140559041 AACTGCATGCAGAAGAGATAGGG - Intergenic
981511795 4:145566059-145566081 AGCTGCTCAGAGAAGTGGTGGGG + Intergenic
981645309 4:146991829-146991851 AGCTGCTTACAGAGGTGGTAGGG - Intergenic
981849973 4:149218648-149218670 AGCTGCTTAGAGAAGTGTTAGGG + Intergenic
982225194 4:153158676-153158698 AAATGCTGGGACAAGTGGTGCGG + Intronic
983420264 4:167507422-167507444 AACTGCTTAGAGAAGTGGTGAGG - Intergenic
984144542 4:176044724-176044746 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
988180650 5:27787094-27787116 AACTGTTTGAAGGAGTGGTCTGG - Intergenic
988193061 5:27964200-27964222 CACTGCTTACAGAAGTGGTAGGG - Intergenic
988200787 5:28066298-28066320 AGCTGCTTAGAGAAGTGCTAGGG + Intergenic
988336334 5:29913568-29913590 AGGTGCTTAGAGAAGTGGTGGGG + Intergenic
988348311 5:30069372-30069394 AACTGCTTAGAGAAGTGGTAGGG + Intergenic
988864873 5:35324102-35324124 AGCTGCTTAGAAAAGTGGTAGGG + Intergenic
988870493 5:35384592-35384614 AGATGCTTAGAGAAGTGGTGAGG + Intergenic
989716454 5:44468620-44468642 AGCTGCATGGAGAGGTGGCAGGG - Intergenic
989733830 5:44679203-44679225 AGCTGCTTAGAGAGGTGGCAGGG + Intergenic
990055746 5:51576134-51576156 AATTGTTTGGGGTAGTGGTATGG - Intergenic
990389559 5:55305036-55305058 AATTACTTGGATAACTGGTAAGG - Intronic
990772062 5:59259203-59259225 AAGTGCTTGAAGTAATGGTAGGG - Intronic
990840869 5:60077753-60077775 AGCTGCTTAGAGAAGTGGAAGGG - Intronic
991028144 5:62052626-62052648 AGCTGCTTAGAGAGGTAGTAGGG - Intergenic
991569800 5:68042151-68042173 AACTGTTTGAGGAAGTGGTGTGG + Intergenic
991577649 5:68121985-68122007 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
992631806 5:78688929-78688951 CTCTGCTTAGAGAAGTCGTAAGG - Intronic
993228840 5:85204990-85205012 AGCTGCTTGGAGAGGTGGTAGGG - Intergenic
993795890 5:92267723-92267745 AGCTGCTTAGAGAAGTTGTAGGG + Intergenic
993944032 5:94097006-94097028 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
994041640 5:95265610-95265632 AACTGCTTGAACAATTGGTCTGG - Intronic
994597611 5:101859950-101859972 AGCTGTTTACAGAAGTGGTAGGG + Intergenic
994970404 5:106730350-106730372 AGCTGCTAAGAGAAGTGGTAGGG + Intergenic
995638341 5:114221989-114222011 AACTTCTTGGTGAATTAGTAAGG - Intergenic
995894622 5:116997967-116997989 AGCTGCTTCGAGAAGTGGTAGGG + Intergenic
996954332 5:129164706-129164728 AGCTGCTTAAAGAAGTGGTAGGG - Intergenic
997424822 5:133796049-133796071 AAGTGGTTGGAGGAGTGGGAGGG - Intergenic
997661354 5:135591616-135591638 AACAGCCTGGAGATGTGGAAGGG + Intergenic
998276034 5:140754018-140754040 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
998756030 5:145380104-145380126 AGCAGCCTAGAGAAGTGGTAGGG - Intergenic
999834261 5:155352415-155352437 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1002176279 5:177403223-177403245 AACTGCTAGGGGCAGGGGTAGGG - Intronic
1004090258 6:12493972-12493994 AGCTGCTTAGAGAAGTTGTAAGG + Intergenic
1004806188 6:19205877-19205899 AGCTGCTTAGAAAAGTGGTAGGG - Intergenic
1006253236 6:32808046-32808068 AGCTGCTTAGAGAAGCCGTAGGG - Intergenic
1007156224 6:39746988-39747010 AACTGCTTTTAGAACTGCTACGG - Intergenic
1007353640 6:41294216-41294238 AGCTGCTTAGAGAGGTAGTAAGG + Intergenic
1008207985 6:48686571-48686593 AATTGCTCAGAGAAGTGGTAGGG + Intergenic
1008332466 6:50260714-50260736 AGCTGCTTAGTGAAGTGGTAGGG - Intergenic
1008687957 6:53945526-53945548 GACTGCTTAGAGAAGTGGTAGGG + Intronic
1009044521 6:58221719-58221741 AATTGCTTTGTAAAGTGGTAAGG + Intergenic
1009355551 6:62740108-62740130 AGCTGCTTCAAGAGGTGGTAAGG + Intergenic
1009446556 6:63749618-63749640 ACCTGCTTGGAGAAGTGATGGGG - Intronic
1009598795 6:65771585-65771607 AGCTGCTTGGAGAGGTGTTGGGG + Intergenic
1009953754 6:70426599-70426621 AACTGCTTCAAGAATTGGGAAGG + Intronic
1011337416 6:86276399-86276421 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
1011757661 6:90520241-90520263 AACTCCTTGAAGGAGTGGTGTGG + Intronic
1011928046 6:92672753-92672775 AGCTGCTTACAGAAGTGGTAGGG + Intergenic
1012288843 6:97425758-97425780 AACTGATTGGAGCAGGGGTGAGG - Intergenic
1012490822 6:99780664-99780686 AACTGCTCAGAGAAGTGGTAGGG - Intergenic
1012693135 6:102341611-102341633 AGCTGCTTGAAGAAATGATATGG + Intergenic
1013106721 6:107032096-107032118 AACTGTTTTGAGAAGTTTTATGG + Intronic
1013393858 6:109714096-109714118 AGCTGCTCAGAGAAGTGGTAGGG - Intronic
1013737819 6:113248421-113248443 AACTGCTTAGAGAAGTGGTAGGG + Intergenic
1014432491 6:121387670-121387692 AACAGTTTGGAGAAGAGGAAAGG + Intergenic
1014841485 6:126225223-126225245 AGCTGCTTGGAGAATTGTTAAGG - Intergenic
1015678753 6:135780995-135781017 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1016237487 6:141886465-141886487 GGCTGCTTAGATAAGTGGTAGGG + Intergenic
1016453735 6:144210087-144210109 AGCTGCTTAGAGAACTGGTAGGG - Intergenic
1018183680 6:161246184-161246206 AGATGCTTGGAGAAGTGATGAGG + Intronic
1019549625 7:1595450-1595472 GACTGCTTGGATGAGTGGGAGGG - Intergenic
1021425536 7:20495683-20495705 AGCTGCTTAGAGCAGTGGTAGGG + Intergenic
1021907933 7:25354280-25354302 AACTTCTTTGAGAAGAGGTTAGG - Intergenic
1021967287 7:25932975-25932997 AGCTTCTTAGAGAAGTGGTAGGG + Intergenic
1022394817 7:29977761-29977783 AAAAGCTTGGAGAAGTGACAGGG - Intronic
1022985218 7:35647298-35647320 CTCTGCTTGGAGGAGTGGGAAGG - Intronic
1024385715 7:48748987-48749009 AGCTGATTAGAGAAGTGGTAGGG - Intergenic
1024704268 7:51939928-51939950 AACTGATTGGGCAGGTGGTAGGG + Intergenic
1026384115 7:69828743-69828765 AAATGCTAGCAGAAGTGATATGG - Intronic
1027505779 7:79016115-79016137 AGCTGCTTAGAGAAGTAGTATGG + Intronic
1027554679 7:79648462-79648484 AGCTGCTTGGAGAAGTGGCAGGG - Intergenic
1027733766 7:81907086-81907108 AGCTGCTTAGAGAGGTGTTAGGG + Intergenic
1027948487 7:84780999-84781021 AACTGCTTAGAGAGGTGATGGGG - Intergenic
1028008816 7:85614557-85614579 AGCTGCTTACAGAAGTGGTGTGG + Intergenic
1028015986 7:85713441-85713463 AAATCCTTGGAGGAGTGGAATGG - Intergenic
1028639672 7:93028812-93028834 AGCTGCTTTGAAAAGTGGTAGGG + Intergenic
1030006245 7:105123444-105123466 AACTGCTTTCAAAAGTGATACGG + Intronic
1030376122 7:108755399-108755421 GGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1030421259 7:109309598-109309620 AGCTGCTTGGAGAGGTGATAGGG + Intergenic
1030454950 7:109761098-109761120 AGCTGCTTAGAGAGTTGGTAGGG - Intergenic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1031026632 7:116686405-116686427 AACTGCCTGGAGGAGAGGTATGG - Intronic
1031965342 7:128024109-128024131 TACTTCTTGGAGCAGTGATAAGG - Intronic
1032310349 7:130780429-130780451 AGCTGCTTGGAGAGGAGGCAGGG - Intergenic
1032879519 7:136074369-136074391 GACTGGATGGAGAAGTGGTAAGG + Intergenic
1032999897 7:137492608-137492630 AGTTGCTTAGAGAGGTGGTAAGG + Intronic
1033494209 7:141877316-141877338 TGCTACTTAGAGAAGTGGTAGGG - Intergenic
1034561144 7:151879959-151879981 AACTGCTGTGCGAAGTGGGATGG + Intergenic
1035053826 7:156020351-156020373 ACATGCTTGGAGCAGGGGTAGGG + Intergenic
1036013274 8:4752160-4752182 TACTTCCTAGAGAAGTGGTAAGG - Intronic
1037248227 8:16861893-16861915 ACCTGCTTAGAGAAATGTTATGG + Intergenic
1037743974 8:21628838-21628860 CACTGATCGGAGAAGTGGCAGGG - Intergenic
1038170620 8:25128458-25128480 TGCTGCTTAGAGAAGTGGTAAGG + Intergenic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1039672036 8:39612484-39612506 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
1040978002 8:53215264-53215286 AGCTGCTTAGAGAAATGGTAGGG - Intergenic
1040981136 8:53247237-53247259 AAATGTTTGCAGGAGTGGTATGG + Intronic
1041024014 8:53665906-53665928 ATCTTCTTGGGGAAGTGGGAGGG - Intergenic
1041404538 8:57483520-57483542 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1041427509 8:57738994-57739016 AGTTGCTTGGAGAGGTGGCAGGG - Intergenic
1041441842 8:57905322-57905344 AACTGAGGGGAGAAGTGGCAGGG + Intergenic
1041577925 8:59421212-59421234 ATCTGCCTAGAGAAGTGGTAGGG - Intergenic
1041702509 8:60806887-60806909 AGCTACTTGGGGAGGTGGTAGGG + Intronic
1041868103 8:62599808-62599830 TACTCCTAGGGGAAGTGGTAGGG - Intronic
1041871132 8:62635490-62635512 AACTGCTTAGGAAAGTGCTATGG + Intronic
1042976826 8:74478749-74478771 AACTGCTTAGACAAGTGGTAGGG - Intronic
1043131961 8:76473087-76473109 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
1043656478 8:82674172-82674194 AGCTGCTTAGAGAACTCGTAGGG + Intergenic
1043698475 8:83251850-83251872 AGCTACTTAGAGAAGTGGTAGGG - Intergenic
1044313694 8:90726143-90726165 AGCTGCTTAGAGAAGTGATAGGG + Intronic
1044527651 8:93269640-93269662 AACTGCTTGGAGGAATGGCAGGG - Intergenic
1044890496 8:96830065-96830087 AGGTCCATGGAGAAGTGGTAAGG - Intronic
1046895019 8:119463217-119463239 AGCTGCTTGGAGAAATGGTAGGG + Intergenic
1048109565 8:131453464-131453486 AGCTGCTTGGAGAGATGGTAGGG + Intergenic
1048119569 8:131564075-131564097 AGCTGCTTAGAGAAGGGCTAGGG - Intergenic
1048637518 8:136313603-136313625 AAATGCTTTTAGAAGAGGTATGG - Intergenic
1048727210 8:137400342-137400364 AGCTGCTTAGAGAGGTGCTAGGG + Intergenic
1049128022 8:140810195-140810217 AGCTGCTTAGAGAAGTGCTAGGG + Intronic
1049619764 8:143592767-143592789 AGCTGCTTGGCGAGGTGGTGTGG + Intronic
1050424756 9:5501775-5501797 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1050475265 9:6034422-6034444 AGCTGCTTAAGGAAGTGGTAGGG + Intergenic
1050676054 9:8053955-8053977 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1051947036 9:22581477-22581499 AGCTGCTTGGAGAGTTGGAAGGG - Intergenic
1052142564 9:25004641-25004663 AGCTGATTAGAGAAGTGGTAGGG - Intergenic
1052534113 9:29726320-29726342 AGCTGCTTAGAACAGTGGTAAGG + Intergenic
1055327886 9:75150930-75150952 GAATGCTTCGAGAAGTGGTGAGG + Intergenic
1055584642 9:77745267-77745289 AACTGCCTGGAGAGGAGGCAGGG + Intronic
1058613241 9:106797880-106797902 AAATGGTTGGAGAAGTGGGAAGG - Intergenic
1058916174 9:109568220-109568242 AGCTACTTGGAGAGGTGGCAGGG + Intergenic
1059591974 9:115671650-115671672 AGCTTCTTGAAGAAATGGTATGG + Intergenic
1059832130 9:118108547-118108569 AACTACTTAGAAAAATGGTAGGG - Intergenic
1060206915 9:121687498-121687520 CACTGCTTTGAGAGGGGGTAAGG + Intronic
1060716414 9:125934032-125934054 AACTGGATGGGGAGGTGGTAAGG - Intronic
1060857481 9:126926551-126926573 ATCTGGTTGGAGAGGTGGTTTGG + Intronic
1203461502 Un_GL000220v1:43902-43924 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1186286072 X:8045367-8045389 CCCAGCTGGGAGAAGTGGTAAGG + Intergenic
1186877622 X:13831745-13831767 AACTGCTTTGAGAGGTTGAAGGG - Intronic
1188492992 X:30755789-30755811 ATCTGCTTAGAGAAGTAGTAGGG + Intergenic
1188768615 X:34126469-34126491 AGCTACTTAGAGAAGTGGTGGGG - Intergenic
1188806869 X:34601666-34601688 AGCTGCTTAGAGTAGTGGTAGGG - Intergenic
1188833691 X:34931671-34931693 AGCTGCTTAGAAAAGTGGTAGGG + Intergenic
1188835293 X:34947823-34947845 AGCCACTTAGAGAAGTGGTAGGG + Intergenic
1189678237 X:43486510-43486532 AGCTGCTTAGAGAGGTGATAAGG + Intergenic
1190064619 X:47231403-47231425 AACTGCTCTGGGAAGTGGTAGGG + Intergenic
1191038921 X:56057864-56057886 ACCTGCTTAAAGAAGTGGTAAGG - Intergenic
1191161195 X:57331183-57331205 AGGTGCTCAGAGAAGTGGTAGGG - Intronic
1191597251 X:62959406-62959428 AGCTGATTAGAGAACTGGTAGGG + Intergenic
1191609941 X:63101740-63101762 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1191643463 X:63452822-63452844 AGCTGCTTGGAGAGGTGGCAGGG + Intergenic
1191661575 X:63657061-63657083 CACTGCTGGGAGATGTGGTATGG + Intronic
1192659848 X:73030608-73030630 AGCTGCTTAGAGAAGTGGTTGGG + Intergenic
1192693516 X:73390729-73390751 AGCTGCTTAGAGAGGTGGCAGGG + Intergenic
1192872282 X:75195535-75195557 AACTGCTTAGAGAAGTGGCAGGG - Intergenic
1192935197 X:75851317-75851339 AGCTGCTTAGAGAAGGGTTAGGG - Intergenic
1193056666 X:77159717-77159739 AGCTGTTTAGAGAAGTGGTAGGG + Intergenic
1193167997 X:78303283-78303305 CACTGCTAGGAGATGTGGGAGGG + Intronic
1193492365 X:82165538-82165560 ACCTGCTTAGAGAAGTGACAGGG + Intergenic
1193577244 X:83214556-83214578 AAGTGTTTGGAGAGGTGGCAGGG + Intergenic
1193580707 X:83259708-83259730 AGCTGTTTAGAGAAGTGGTAGGG + Intergenic
1193593451 X:83418865-83418887 AGGTGCTTAGAGAAGTGGTAGGG + Intergenic
1193611040 X:83631640-83631662 TGCTGCTTAGAGAAATGGTAGGG - Intergenic
1193703330 X:84790726-84790748 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1193749761 X:85327105-85327127 AGATGCTTAGAGAAGTGGTAGGG - Intronic
1193790325 X:85808732-85808754 AGGTGCTTAGAGAAGTGGTAGGG - Intergenic
1193823439 X:86194681-86194703 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
1193883891 X:86960926-86960948 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1193891394 X:87050266-87050288 AGCTGCTTAGAGAGGTGGCAGGG - Intergenic
1193923248 X:87455163-87455185 AGCTGCTTAGAGAATTGGTAAGG + Intergenic
1193944840 X:87722731-87722753 AGCTGCTTGGAGAGTTGGCAGGG - Intergenic
1193960024 X:87914228-87914250 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1194323625 X:92481784-92481806 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1194344965 X:92751599-92751621 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1194346585 X:92773200-92773222 AGCTGCTTAGAGAAATGGTAGGG + Intergenic
1194526058 X:94978468-94978490 AGCTGCTTAGAGAAGGGGTATGG - Intergenic
1194549094 X:95274020-95274042 AGCTACTTAGAGAAGTTGTAGGG + Intergenic
1194663795 X:96655604-96655626 TGCTGCTTAGAGAAGTGGTGGGG + Intergenic
1194848318 X:98839257-98839279 AGCTGCTTGGAGAAGTGACAGGG - Intergenic
1194925552 X:99819638-99819660 AGCTGCTTAGAGAAGTGGTAAGG + Intergenic
1195270064 X:103220480-103220502 AGCTGCTCAGAGAAGTGGTAGGG + Intergenic
1195533403 X:105982840-105982862 AGCTGCTTAGAAAAGTAGTAGGG - Intergenic
1195544638 X:106100945-106100967 AATTGCTTAGAGAAGTTGCAGGG - Intergenic
1195567950 X:106363862-106363884 AGCTGCTTAGAGAAGTAGTAGGG - Intergenic
1195934216 X:110109674-110109696 AAGTCCTTGGAGAAGTGGACAGG - Intronic
1196070441 X:111515382-111515404 AGCTGCTGGGAGAAGTGGTGAGG + Intergenic
1196468090 X:115993323-115993345 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1197141382 X:123121491-123121513 AGCTGCTCAGAGAAGTTGTAGGG + Intergenic
1197370700 X:125622151-125622173 AGCTTCTTAGAGAAGTGGTAGGG - Intergenic
1197378793 X:125713514-125713536 ATCTGCTTAGAGAAGTAGTGGGG + Intergenic
1197570616 X:128146732-128146754 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1198779676 X:140221443-140221465 AGCTGCTTACAGAAGTGGTCAGG + Intergenic
1198885129 X:141327209-141327231 TGCTGCTCAGAGAAGTGGTAGGG + Intergenic
1198975185 X:142327983-142328005 AGCTGTTTAGAGAAGCGGTAGGG - Intergenic
1199136960 X:144265468-144265490 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1199270172 X:145873410-145873432 AGCTGCTTAGAGAAGAGGTAGGG - Intergenic
1199400088 X:147389241-147389263 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
1199560915 X:149161597-149161619 AGCTGCTTAGAGAAGTGTTAGGG + Intergenic
1199640675 X:149858242-149858264 AGCTACTTAGAGAGGTGGTAGGG + Intergenic
1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG + Intronic
1199786727 X:151112650-151112672 AACTGCTTGGAGAAGTGGTAGGG - Intergenic
1200631727 Y:5594946-5594968 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1200653305 Y:5868241-5868263 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1200654922 Y:5889844-5889866 AGCTGCTTAGAGAAATGGTAGGG + Intergenic