ID: 949751088

View in Genome Browser
Species Human (GRCh38)
Location 3:7353494-7353516
Sequence AGGCATCTCCAGCTCATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 10, 3: 14, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949751088_949751093 6 Left 949751088 3:7353494-7353516 CCATGAATGAGCTGGAGATGCCT 0: 1
1: 0
2: 10
3: 14
4: 151
Right 949751093 3:7353523-7353545 CCTTGGTTTACTGTAGAGAAAGG 0: 1
1: 11
2: 170
3: 216
4: 297
949751088_949751094 7 Left 949751088 3:7353494-7353516 CCATGAATGAGCTGGAGATGCCT 0: 1
1: 0
2: 10
3: 14
4: 151
Right 949751094 3:7353524-7353546 CTTGGTTTACTGTAGAGAAAGGG 0: 2
1: 13
2: 181
3: 190
4: 408
949751088_949751096 16 Left 949751088 3:7353494-7353516 CCATGAATGAGCTGGAGATGCCT 0: 1
1: 0
2: 10
3: 14
4: 151
Right 949751096 3:7353533-7353555 CTGTAGAGAAAGGGATTCACGGG 0: 1
1: 0
2: 9
3: 52
4: 515
949751088_949751095 15 Left 949751088 3:7353494-7353516 CCATGAATGAGCTGGAGATGCCT 0: 1
1: 0
2: 10
3: 14
4: 151
Right 949751095 3:7353532-7353554 ACTGTAGAGAAAGGGATTCACGG 0: 1
1: 1
2: 1
3: 25
4: 244
949751088_949751097 30 Left 949751088 3:7353494-7353516 CCATGAATGAGCTGGAGATGCCT 0: 1
1: 0
2: 10
3: 14
4: 151
Right 949751097 3:7353547-7353569 ATTCACGGGCTTAAGAAGATTGG 0: 1
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949751088 Original CRISPR AGGCATCTCCAGCTCATTCA TGG (reversed) Intronic
903443548 1:23406190-23406212 AGCCAGCTCCAGCTGATGCATGG - Intronic
904053447 1:27655170-27655192 AGGTATCTCCCCCTCATCCAGGG - Intergenic
908645626 1:66275012-66275034 AGAGTTCTCCAGCTCATACATGG + Intronic
909172881 1:72317534-72317556 AGGCATTTCCAGCTCACTCAGGG + Intergenic
910759960 1:90724003-90724025 AGGCAGGTCCAGCTCTTTCCTGG - Intergenic
912944098 1:114070251-114070273 AGGCATTTCCAGCTCACTCACGG + Intergenic
915638659 1:157204323-157204345 ATGCATGTCCAGCCCATCCAGGG + Intergenic
918371202 1:183863202-183863224 AGGTCTCTGCAGATCATTCAGGG + Intronic
920749025 1:208656676-208656698 AGCCATCTCCACCTCATTGTAGG + Intergenic
920949243 1:210557059-210557081 ATGCTCCTCCAGCTCATTCAGGG - Intronic
922581497 1:226701904-226701926 AGCCATTTCCTGCTCATTCACGG + Intronic
922743931 1:228032434-228032456 TGGCAACTCCAGCTGCTTCAAGG + Intronic
924182733 1:241455520-241455542 AGGCATTTCCAATTCATTTATGG + Intergenic
1063251924 10:4283021-4283043 AGGCAACTGCAGCTCCTTGAGGG + Intergenic
1063419362 10:5898913-5898935 AGACATCTCCATCTCATTGATGG + Intronic
1064741840 10:18442063-18442085 TGGTATGTCCACCTCATTCAGGG - Intronic
1067836828 10:49646600-49646622 AGGGCACTCCAGCTCCTTCACGG + Exonic
1068911779 10:62386136-62386158 ATGCATCCCCAGCCCTTTCATGG - Intronic
1069759537 10:70799160-70799182 AGGTATCTGCAGCTCAGGCAAGG - Intergenic
1070496391 10:77027891-77027913 AGGCTTCTCCATCTCATTGCAGG - Exonic
1070544766 10:77443361-77443383 GGGCATCTGCAGAGCATTCATGG + Intronic
1073656928 10:105426315-105426337 AGGCATTTCCAGCTCACTCATGG + Intergenic
1076122885 10:127950364-127950386 AGGCATCTCCAACTCAGTCATGG - Intronic
1078328489 11:10399211-10399233 AGGCATCGCCACCTACTTCAAGG - Intronic
1079818595 11:25094755-25094777 AGCCACCTCCAGCTCTTCCAGGG + Intergenic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1091844470 12:3645270-3645292 ATGCTTCTCCCGCTCCTTCAAGG - Intronic
1091874993 12:3926169-3926191 AGGCATCTTCATCTCCTACATGG - Intergenic
1092299437 12:7231479-7231501 AGTCATCTCCATCTCAGTGAGGG - Intergenic
1094492484 12:30969752-30969774 AAGCATTTCCAGCACATTCCTGG + Intronic
1095650423 12:44601588-44601610 GGGCATCTCCAGCTAACTCAAGG + Intronic
1096415996 12:51414043-51414065 AGACATCTCCTGCTCATGGATGG - Intronic
1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG + Intronic
1105045785 12:133002161-133002183 AGGCTTCTCCACCTCCTTAAAGG + Intronic
1106004865 13:25759344-25759366 AGGCATCGTGAGCTCATGCACGG - Intronic
1107129438 13:36879516-36879538 AGCCCTCTCCAGCTCGTCCATGG + Exonic
1107832546 13:44387201-44387223 ATGCTTCCCCAGCCCATTCATGG + Intronic
1112013078 13:95308251-95308273 TGGCCTCTTCAGCTCATCCATGG + Intergenic
1113057899 13:106289280-106289302 AGGGATCTGCAGTCCATTCAGGG + Intergenic
1116058636 14:39894847-39894869 AGGCATTTCCAGCTCACTCATGG - Intergenic
1119928412 14:78519742-78519764 AGGCAACTCCTACTCCTTCAAGG - Intronic
1120169105 14:81231440-81231462 AGTCATCTCCAACTCACTCTTGG - Intergenic
1120593295 14:86402355-86402377 AGAGATCTGAAGCTCATTCAAGG + Intergenic
1121782311 14:96629819-96629841 AGGCATGCCCAGCCCTTTCAAGG + Intergenic
1122206003 14:100148354-100148376 AGGTAACTCCAGCTCTTTCCAGG + Intronic
1122376012 14:101257810-101257832 AGACGTCTCCAGATCATGCAGGG + Intergenic
1123148549 14:106158330-106158352 AGGCATGTCCAGCTCTGTCCTGG - Intergenic
1124137688 15:27049116-27049138 ATGCATCTCCTGCACATGCAGGG + Intronic
1127225100 15:56919336-56919358 AAGCACCCCCAGCTCATCCAAGG - Intronic
1128160459 15:65420408-65420430 AGGAAGCTCCAGCTCCTTCGAGG - Intronic
1129538035 15:76330084-76330106 TGGTAGCTCCAGGTCATTCATGG + Intergenic
1129961671 15:79692151-79692173 AGGCATTTCCAGCTCACTCACGG + Intergenic
1130068854 15:80629566-80629588 AGCCATTACCAGCTCACTCAAGG - Intergenic
1130094237 15:80844250-80844272 AGGCAGCTGCAGCTCATCCCAGG - Intronic
1135061973 16:19278824-19278846 AGGCATCTCCAGCTCCATCATGG + Intergenic
1136681666 16:31969309-31969331 AGGCATGTCCAGCTCTGTCCTGG + Intergenic
1136781971 16:32910811-32910833 AGGCATGTCCAGCTCTATCCTGG + Intergenic
1136887819 16:33943041-33943063 AGGCATGTCCAGCTCTGTCCTGG - Intergenic
1138935649 16:61718690-61718712 AGCCATATAAAGCTCATTCATGG - Intronic
1141592117 16:85076344-85076366 AGCCATCTCCAGCCCATCCCTGG - Intronic
1203084630 16_KI270728v1_random:1174797-1174819 AGGCATGTCCAGCTCTGTCCTGG + Intergenic
1143373839 17:6455871-6455893 AGGCACCTCCAGCTTCTCCAAGG + Intronic
1145295737 17:21591620-21591642 AGGCATCTCCTGGTCTCTCATGG + Intergenic
1145368044 17:22280437-22280459 AGGCATCTCCTGGTCTCTCATGG - Intergenic
1151165247 17:72197951-72197973 AGGCATCTCCAGCCAAGGCATGG - Intergenic
1152710245 17:81867708-81867730 AGACACCCCCAGCTCCTTCAGGG + Exonic
1153246084 18:3073794-3073816 TGGCCTCTTCAGCTCATCCACGG + Intronic
1154344138 18:13528245-13528267 AGGCGTCTCCAGCTCAGTGCTGG - Intronic
1158018697 18:52814892-52814914 AGCCATCACCACCTCATTCCAGG - Intronic
1158869180 18:61667712-61667734 AAGCAGCTCCAGCGCATCCAAGG - Intergenic
1162609110 19:11735680-11735702 AGGCTTCTCCACCCCAGTCAAGG + Intronic
1165991008 19:39813756-39813778 AAGCAACTCCAGCCCATTCATGG + Intergenic
1166941250 19:46367458-46367480 GGGCATCTCCAGCTCACTCCTGG - Intronic
1167000147 19:46741074-46741096 AGGCAGCTCCAGCTAAAACATGG + Intronic
1168223548 19:54978428-54978450 AGGTTTCACCATCTCATTCAGGG + Intronic
930205329 2:48582003-48582025 CGGCAACTCAAGGTCATTCAAGG - Exonic
931648193 2:64444421-64444443 AGGCAGGTCCAGCTCCTACAGGG + Intergenic
932474590 2:71994612-71994634 AGGCATCCCCAACTAATGCAAGG - Intergenic
933043566 2:77503022-77503044 AGGCAGGGCCAGGTCATTCAGGG + Intronic
935564589 2:104592327-104592349 AGGCATTTCCAGCTCCCTCACGG + Intergenic
936460708 2:112712200-112712222 AGGCCTCCCCAGCTCATGAATGG + Intergenic
937705495 2:124915739-124915761 AGGCACCTTGAGCTCATCCATGG + Intergenic
940377534 2:152972400-152972422 GGGCATCTCCATCCCACTCAAGG + Intergenic
942987648 2:182161944-182161966 AGGCATCCCCAGCTCACTCCTGG - Intronic
947610249 2:231520752-231520774 TGGCATTTCCAGATCATTCCTGG - Intergenic
947906608 2:233768370-233768392 AGTCATTTCCAGAACATTCAGGG - Exonic
948538526 2:238667215-238667237 AGGCATCTCCAACTCGCTTATGG - Intergenic
1170224541 20:13977323-13977345 AGCCATCTCAGGCTCTTTCATGG - Intronic
1170947492 20:20904339-20904361 AGGCACCTCCAGCTCCAGCATGG - Intergenic
1173185062 20:40834243-40834265 CCCCATCTCCAGCTCCTTCAGGG - Intergenic
1174267215 20:49340629-49340651 TGACATCTCCTGCCCATTCAGGG + Intergenic
1175497049 20:59422482-59422504 CTCCATCTCCAGCTCTTTCAAGG + Intergenic
1176119270 20:63446690-63446712 AGGCAGCTCCAGCTCCTTCCTGG + Intronic
1177587040 21:23110558-23110580 AGGCCTCTCCAGCCCAACCAAGG - Intergenic
1179383251 21:40918981-40919003 AGACGTCTCCAACTCATTCAGGG - Intergenic
1180582882 22:16858185-16858207 AAGCATGTCCAGCTGATGCATGG - Intergenic
1181538035 22:23556849-23556871 AGGCATCTCCAGCAGTCTCATGG - Intergenic
1184293888 22:43511964-43511986 AGGCAGCTTCTGCTCAGTCAAGG + Intergenic
949751088 3:7353494-7353516 AGGCATCTCCAGCTCATTCATGG - Intronic
952654380 3:35767095-35767117 AGGTTTCTCCATCTCATGCATGG - Intronic
954448992 3:50561597-50561619 AGGCCTGTCCTGCCCATTCATGG - Intronic
954660241 3:52223200-52223222 GTGCATGTCCAGCTCCTTCAGGG + Exonic
962184575 3:133244445-133244467 AGCCATCTCCAGCCCTTACATGG - Intronic
963406201 3:144867191-144867213 AGGCAGCTTCAACTCATGCAAGG + Intergenic
969447461 4:7253428-7253450 AGGGATCTGTAGCTCATTCCAGG + Intronic
976510063 4:85898254-85898276 AACCATCTCCATCTCATACATGG + Intronic
977673238 4:99719539-99719561 AAGGAGCTCCAGCTCATTAATGG + Intergenic
979074964 4:116259640-116259662 AGGAATCTCTAGCTAACTCACGG - Intergenic
981770062 4:148299015-148299037 TGGCCTCTTCAGCTCATGCATGG + Intronic
984106146 4:175548990-175549012 TGTCATCTCTAGCTCATGCACGG + Intergenic
985796229 5:1964135-1964157 GGGCATCTGCAGGTCCTTCAGGG - Intergenic
985867817 5:2529032-2529054 AGGCAGCTCCTGCTCCATCATGG + Intergenic
986381741 5:7193747-7193769 AGGCATCAACAGTGCATTCAAGG + Intergenic
986767206 5:10939008-10939030 AGGCTTCTCCAGCTGGCTCAGGG - Intergenic
986854706 5:11855142-11855164 TGGCATCTCCAGCTAATCCCTGG - Intronic
987578629 5:19760431-19760453 AGGCATTTCCAGCTTGCTCACGG + Intronic
987621553 5:20342808-20342830 AAGCATTTCCAGCTCACTCATGG - Intronic
988115904 5:26891039-26891061 AGGAATATCCAGCTGAATCAAGG + Intronic
989212931 5:38874802-38874824 AGGAAACTCAAGCTCAATCAGGG - Intronic
989824037 5:45832317-45832339 AGGCATTCACAGCTCAATCAAGG - Intergenic
991489148 5:67166060-67166082 AGGCTTCTCCAGCACCTCCAGGG - Exonic
993163555 5:84320472-84320494 AGCCAGCTCCAGCCCATCCAAGG + Intronic
994158593 5:96530359-96530381 AGGCTTCTCTAGCTCAGTAAAGG - Intronic
994356121 5:98795563-98795585 AGGCATCTCCTTCTTACTCATGG + Exonic
994979480 5:106855148-106855170 GGGCCTCTTCAGCTCATGCATGG + Intergenic
997864665 5:137450479-137450501 CAGCACCTCCAGCTCAATCAGGG + Intronic
1002109627 5:176899622-176899644 AGGCGCCTCCAGCTCCTTCTAGG - Intergenic
1003470176 6:6422170-6422192 AGGCATCTCCAGCTTCTTCACGG + Intergenic
1005172104 6:22999355-22999377 AGATATTTTCAGCTCATTCATGG + Intergenic
1006982201 6:38155551-38155573 AGCCATCAGCAGCACATTCAGGG + Intergenic
1007413627 6:41679451-41679473 AAGCTTCTCCATCTCTTTCAGGG - Intergenic
1007414814 6:41685064-41685086 CTGCATCTCCAGCTCCTGCAGGG + Exonic
1010323303 6:74538390-74538412 AGGCATTTCCAGCTCACTTACGG - Intergenic
1010374001 6:75145135-75145157 AGGCATCTCAAATTCATTCGAGG - Intronic
1011774310 6:90711328-90711350 ACGCTTCTGCAGCTTATTCATGG - Intergenic
1014036225 6:116769572-116769594 AGGCAGGTCCAGATCATACAGGG - Intergenic
1015586332 6:134779962-134779984 AGGCAGGACCAGCTCATGCAAGG - Intergenic
1016200990 6:141408400-141408422 AGGCATCTTCAGCACAGGCAAGG - Intergenic
1016561125 6:145396205-145396227 TGGCAGCTCCAGCTCCTGCAGGG + Intergenic
1017151241 6:151282425-151282447 AGGGACCTCCAGCTCACGCATGG + Intronic
1019256992 7:58937-58959 AGGCATCTCCTGTTCATTCCCGG + Intergenic
1020432282 7:8126379-8126401 AGGTTTCACCACCTCATTCACGG - Intronic
1020751536 7:12147327-12147349 AGGCATCTCTGACTCACTCATGG + Intergenic
1021507408 7:21401112-21401134 TGGAATCTCCATCTCCTTCATGG + Intergenic
1024001952 7:45195551-45195573 AGTCATCTCCCTCCCATTCAGGG - Intergenic
1024642528 7:51341920-51341942 AGGCATGGGCAGCTCTTTCATGG - Intergenic
1031203351 7:118720590-118720612 AGGCAGATCCAGTTCATACATGG + Intergenic
1032923696 7:136577897-136577919 AGGCATTCCCAGCTCATTCACGG + Intergenic
1034282005 7:149861190-149861212 GGGGATGTCCAGCTCATCCAGGG - Exonic
1036970374 8:13348341-13348363 AGGCGGTGCCAGCTCATTCAGGG + Intronic
1037084293 8:14827910-14827932 AGGGATCTTCAAATCATTCATGG + Intronic
1044478258 8:92654073-92654095 AGGCATCACCACCATATTCAAGG + Intergenic
1045012445 8:97969938-97969960 AAGCATGTCCAGCTGATGCAGGG + Intronic
1047341011 8:123980654-123980676 AGGCAACTTGAGCTCCTTCAGGG - Exonic
1049255639 8:141612238-141612260 GGGCATCTCCAGCCCAGACAGGG - Intergenic
1049608088 8:143539008-143539030 AGACAGGTCCAGCTCAGTCAGGG - Exonic
1049776195 8:144406464-144406486 TGCCACCTCCAGCTCTTTCATGG + Intronic
1049940923 9:545320-545342 AAGCATCTACAGATCATTGAAGG + Intronic
1057624983 9:96668892-96668914 AGGCATCAGAAGTTCATTCAAGG - Intergenic
1057891892 9:98875856-98875878 AGGATGCTCCAGGTCATTCAGGG + Intergenic
1058116132 9:101085978-101086000 AGGCATCTACAAAACATTCATGG - Intronic
1059846969 9:118290684-118290706 AGGAATTTGCAGCTCTTTCATGG + Intergenic
1060450751 9:123736644-123736666 ATGCATCTCAAACACATTCATGG + Intronic
1060739399 9:126088342-126088364 TGGCATATCCTGCTCATCCATGG + Intergenic
1061153940 9:128845866-128845888 AGGCCTGACCAGGTCATTCAGGG - Intronic
1062626934 9:137447646-137447668 AGCCACCTCCAGCTCTTCCAGGG - Exonic
1186188414 X:7044246-7044268 AGGCATCTCAAACTTATTTAAGG + Intergenic
1186509650 X:10121199-10121221 AGGCATCTACAGCTGAGTCTGGG + Intronic
1188452921 X:30327828-30327850 AGGCATCTCCAGATTCATCAAGG + Intergenic
1189725096 X:43960236-43960258 AGGCTTCCCCAGCTAATTAATGG - Intronic
1190994363 X:55592001-55592023 AGGCATCTCCGGCCCAATAAAGG + Intergenic
1192297991 X:69870092-69870114 AGGCATTTCCAGCTCACTCATGG + Intronic
1193960012 X:87914163-87914185 AGGCATCTGGAGCCCAATCAAGG + Intergenic
1195733812 X:107992730-107992752 CTGCACCTCCAACTCATTCAGGG - Intergenic
1199741665 X:150741384-150741406 AGGCATCTCCCTGTCCTTCAAGG + Intronic
1201529896 Y:14980116-14980138 AGGCATTTCCAGCTCACACACGG + Intergenic