ID: 949754334

View in Genome Browser
Species Human (GRCh38)
Location 3:7392089-7392111
Sequence GTTCAAACCACACCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949754334_949754339 3 Left 949754334 3:7392089-7392111 CCCTCCTTTGGTGTGGTTTGAAC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 949754339 3:7392115-7392137 GGAGTAGATCTCCAGGTAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 123
949754334_949754338 -4 Left 949754334 3:7392089-7392111 CCCTCCTTTGGTGTGGTTTGAAC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 949754338 3:7392108-7392130 GAACTGAGGAGTAGATCTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949754334 Original CRISPR GTTCAAACCACACCAAAGGA GGG (reversed) Intronic
901427557 1:9192124-9192146 GGTCAATCTACACTAAAGGATGG + Intergenic
901763205 1:11484002-11484024 GTCCAAACCACACCAGGGAAGGG + Intronic
908621463 1:65985621-65985643 GTAAAAACCACACTAAAAGAGGG - Intronic
908652526 1:66351515-66351537 CTTCAGACCATAACAAAGGAAGG - Intronic
908832167 1:68190390-68190412 GTTCAACCCACACTCAAGGGAGG - Intronic
914005210 1:143726938-143726960 GTTTAAACCACACTACAGAAAGG - Intergenic
914097688 1:144558159-144558181 GTTTAAACCACACTACAGAAAGG - Intergenic
914301305 1:146379458-146379480 GTTTAAACCACACTACAGAAAGG + Intergenic
914508745 1:148311713-148311735 GTTAGAACCACATCAAATGATGG - Intergenic
914517489 1:148386326-148386348 GTTTAAACCACACTACAGAAAGG - Intergenic
915852940 1:159347361-159347383 TTCCAAACCACAGAAAAGGAGGG + Intergenic
916528522 1:165633644-165633666 GTACCAACCACCCCAAAGGAAGG - Intronic
919364768 1:196644342-196644364 GTTCAAACCTAGCAAAAGGAAGG + Intergenic
919638606 1:200028327-200028349 TTTCAACCCACACAAAAGTATGG + Intronic
920536261 1:206738541-206738563 GTTCAGACCACAAGACAGGAGGG - Intergenic
923305133 1:232681672-232681694 GTCAAAGCCACTCCAAAGGAAGG - Intergenic
1065364889 10:24925828-24925850 GTTCCAACCCCACCTAAGGTCGG - Intronic
1065423064 10:25568505-25568527 GTTCCAGCCACACCAAAAGCTGG + Intronic
1068677392 10:59782150-59782172 GTTCAAGCTAAACCAAATGACGG + Intergenic
1070146602 10:73778443-73778465 GTTCAAACCACAGCAACAGAAGG - Intronic
1071126070 10:82336347-82336369 CTTCAGACAACACAAAAGGAGGG + Intronic
1074909420 10:117894208-117894230 GTTCTAACTACCCCAAGGGAAGG + Intergenic
1077526249 11:3067548-3067570 GTCCAAACCAAACACAAGGATGG + Intergenic
1078696876 11:13642917-13642939 GTTCAATCCACACTTAAGGTGGG - Intergenic
1079139414 11:17798089-17798111 CTTCAAACCAGACAAAAGAAAGG + Intronic
1079262789 11:18899756-18899778 TTTCAAACCACTGAAAAGGAGGG + Intergenic
1080892453 11:36421196-36421218 ATTGAAACCACACCAAACCATGG - Intronic
1082947486 11:58775156-58775178 GCTCCAACCACACCAGAGGCTGG + Intergenic
1087439624 11:98165607-98165629 TTTCAATACACACCAGAGGAAGG + Intergenic
1089375080 11:117988398-117988420 CTTCAAACCACACAGACGGAGGG - Exonic
1089383337 11:118051704-118051726 CATCAAAACACACCACAGGAAGG + Intergenic
1095720826 12:45398924-45398946 GTTTAAACAACAGCAAAAGAGGG + Intronic
1098310785 12:69146938-69146960 GTTCAAACAACCCTTAAGGAGGG + Intergenic
1099509416 12:83515420-83515442 TACCAAACCACACCAAATGAAGG - Intergenic
1101991184 12:109486740-109486762 GTCCAACACACACCAAAGGAGGG - Intronic
1102143132 12:110633344-110633366 ATTAAAACCAAACCAAAGGCTGG + Intronic
1102671774 12:114625475-114625497 GATCAAACCACACAAAAGCCAGG - Intergenic
1105350591 13:19611672-19611694 GTTCTCACCACACCAAAAAAAGG - Intergenic
1107712961 13:43168826-43168848 GTTGAAACCACAAACAAGGAGGG + Intergenic
1108488142 13:50949244-50949266 GTTCAGACAACACCAAAACAAGG + Intronic
1111849615 13:93555816-93555838 GTTCAGTCCAGACCAAAGAATGG - Intronic
1113209765 13:107962722-107962744 GTTTAATACACACTAAAGGAAGG + Intergenic
1114129620 14:19775141-19775163 GTTAAAACCACAAAAAAAGAGGG - Intronic
1119092649 14:71799198-71799220 GTGCAAACCCCACAAAAGTAGGG + Intergenic
1121671715 14:95715054-95715076 GTTCAAACATCACCATGGGATGG + Intergenic
1122668715 14:103353635-103353657 GTTCATCCCACATCAAAGCAAGG - Intergenic
1122672302 14:103382154-103382176 GCTCAAGCAACAACAAAGGAAGG + Intergenic
1123061242 14:105595553-105595575 GTCCAAACAACACCAGAGGAGGG - Intergenic
1123085697 14:105716464-105716486 GTCCAAACAACATCAGAGGAGGG - Intergenic
1123572896 15:21632891-21632913 GTTAAAACCACAAAAAAAGAGGG - Intergenic
1123609516 15:22075478-22075500 GTTAAAACCACAAAAAAAGAGGG - Intergenic
1124345819 15:28920733-28920755 CTTCCTACCACACCAAACGAGGG - Intronic
1129104630 15:73297745-73297767 TTTCAGATCACACCAAATGAAGG - Intronic
1130290879 15:82599687-82599709 GTTCAAAACATACCCAAGAAGGG + Intronic
1135566157 16:23512640-23512662 GTTCAAACCAGTCCAAAGAATGG - Intronic
1139258784 16:65571718-65571740 GTTCAAAAAACACAAAAGAATGG + Intergenic
1148256674 17:46139562-46139584 GTTCATATCACTCCAAAGGCTGG - Intronic
1148518261 17:48242705-48242727 GTTCAAACCACACCATCAAATGG - Intronic
1149664217 17:58354480-58354502 GTTCAGAGCTCACCCAAGGAGGG + Exonic
1152504454 17:80738362-80738384 GTGCAAACCACAGAAAGGGATGG - Intronic
1155509313 18:26561313-26561335 ATTCAAACAACACCAAAGCATGG - Intronic
1156029352 18:32694287-32694309 GTTCAAATCACATCTAAAGAAGG + Intronic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1159488995 18:69104937-69104959 ATTTAAACCACACCTAAGAATGG - Intergenic
1161330568 19:3684979-3685001 TTTCAGACGGCACCAAAGGATGG - Intronic
925025348 2:602696-602718 GTTCAAAGAACAGCAAAGGCTGG + Intergenic
929557004 2:42931853-42931875 GAACAAACCACACCTAACGAAGG + Intergenic
932027353 2:68148803-68148825 ATTCAAACAAAACAAAAGGATGG + Intronic
932692967 2:73929123-73929145 GGCAAGACCACACCAAAGGAGGG - Intronic
936266071 2:111008144-111008166 AATAAAACCACACCAAAAGAGGG - Intronic
936492349 2:112983150-112983172 GTACAAACCACACCATAACATGG - Intronic
942888840 2:180962800-180962822 GTTCAACCCATACCAAAGCCCGG + Intergenic
945996622 2:216442437-216442459 ATTCAAACAATACAAAAGGATGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947333364 2:229053986-229054008 GTTCTAATCACACAAATGGATGG + Intronic
947989054 2:234472822-234472844 GCTCATACCCCACCAAAGGGAGG + Intergenic
1171900673 20:30853426-30853448 TTTGACCCCACACCAAAGGAAGG + Intergenic
1172099587 20:32477153-32477175 GTTCAAACCATAACAACAGAAGG + Intronic
1173090038 20:39961841-39961863 ATTCATACTATACCAAAGGATGG + Intergenic
1181460448 22:23083115-23083137 CTGGAAACCATACCAAAGGAGGG + Intronic
1183157399 22:36085893-36085915 CTCCAAAACACAACAAAGGAAGG + Intergenic
949754334 3:7392089-7392111 GTTCAAACCACACCAAAGGAGGG - Intronic
949994139 3:9602903-9602925 GTTCTCAAAACACCAAAGGAGGG + Intergenic
951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG + Intergenic
952149974 3:30578659-30578681 GTTCAAACCACAAAGAGGGAGGG - Intergenic
955146828 3:56327926-56327948 GTTCAGAAAACACCAAATGAAGG + Intronic
955479932 3:59379363-59379385 GTTCAAAACACACAACAGGTAGG + Intergenic
956798545 3:72737325-72737347 GTTAAAACCACAGCCACGGAAGG + Intergenic
956799566 3:72744685-72744707 TTTCAATCCATACCAAATGAAGG - Intergenic
957444535 3:80298273-80298295 TTTCAAACCACAGTAAAGGTAGG - Intergenic
957472888 3:80682441-80682463 CTTAAAACCACACCAATTGAGGG + Intergenic
961238206 3:125386929-125386951 GCTCAGCCCACACAAAAGGAAGG + Intergenic
962046882 3:131769765-131769787 GTTCAACCCAAAATAAAGGAGGG - Intronic
962878526 3:139554328-139554350 GGCCAAACCACACCACTGGAGGG - Intergenic
962911856 3:139859488-139859510 GTTCAACCCACTACAACGGAAGG - Intergenic
963219897 3:142797444-142797466 GAGCAAATCAGACCAAAGGAGGG + Intronic
963750576 3:149175141-149175163 ATGTAAACCACACAAAAGGATGG - Intronic
967908817 3:194524288-194524310 GTTCAAATCACACCAATAAAAGG - Intergenic
968386194 4:140517-140539 GGCCAAACCATACCAAAGGAGGG - Intronic
970424496 4:15933804-15933826 CTTCAAGCCACAGCAAAGAAAGG - Intergenic
974471133 4:62319310-62319332 GTCCAACCCACACTCAAGGATGG - Intergenic
974733862 4:65902536-65902558 GAACAAACCAAACCCAAGGATGG - Intergenic
978392043 4:108237124-108237146 GAACAAACCACAATAAAGGAGGG + Intergenic
978646485 4:110938611-110938633 ATTCAAACAACTCCAAAGAAGGG - Intergenic
981004442 4:139860554-139860576 GTTCAAACCTCAGGAAAGGCGGG + Intronic
981332062 4:143522260-143522282 TTTCAACCACCACCAAAGGACGG - Intronic
982687900 4:158514050-158514072 GTTCAAATCAATGCAAAGGAAGG + Intronic
983688463 4:170438512-170438534 GTTCCCCCCACACCAAGGGAAGG - Intergenic
985213861 4:187628255-187628277 ATTAAAACCACACAAAAGAACGG + Intergenic
987819721 5:22947359-22947381 TTTCCACCCACACCCAAGGAGGG - Intergenic
987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG + Intergenic
990417900 5:55604187-55604209 GTTCAAACCATGCTAAAAGAAGG - Intergenic
991725495 5:69531624-69531646 GCTCAGACCCCACCACAGGAGGG - Intronic
995341975 5:111070573-111070595 GTTCCAGCAACACCAATGGAGGG - Intronic
998615364 5:143734560-143734582 TTTCAAAGCACTCCACAGGAAGG - Intergenic
1006239051 6:32661575-32661597 ATTCAGACCACCCCTAAGGAGGG + Intronic
1006269792 6:32955279-32955301 GTTCAAAACACAGTAGAGGAGGG + Intronic
1006907454 6:37542486-37542508 GTCCCGACCACACCTAAGGAAGG - Intergenic
1011765722 6:90617363-90617385 GTTTAAACCAAACCCAAGGCAGG - Intergenic
1012075347 6:94675813-94675835 TTTCAAACCATAGAAAAGGAGGG + Intergenic
1012324670 6:97901318-97901340 GTACTAACCACCCCAAAGGAAGG - Intergenic
1018090284 6:160340559-160340581 GTTCCAGCCACACCCAAGCATGG - Intergenic
1018360627 6:163063720-163063742 AGTGAAACCAAACCAAAGGACGG + Intronic
1024215436 7:47244451-47244473 GGTCAAACCACACAAAAAGGAGG + Intergenic
1024329079 7:48138890-48138912 GGCCAAACCAAGCCAAAGGAGGG + Intergenic
1024329683 7:48143591-48143613 GTTCTAGCCACACCACAGTATGG - Intergenic
1024972169 7:55080692-55080714 GTTCTCACCACACCAAAAAAAGG + Intronic
1029057507 7:97761620-97761642 GTTCAAACCTATCCCAAGGAAGG + Intergenic
1030640951 7:112005897-112005919 TTTCAAAACACAGCAAAGGCTGG - Intronic
1032728016 7:134610081-134610103 GTAAAAACCATACCAAAGGCTGG + Intergenic
1032915487 7:136484414-136484436 GTTGAAACCACAATAAAGGAGGG + Intergenic
1035429719 7:158809808-158809830 GTTCAAACCACATCCAAATAAGG + Intronic
1039158723 8:34593102-34593124 GTTCTCACCACACCAAAAAAAGG + Intergenic
1041394814 8:57379489-57379511 TTTCCAAGCACATCAAAGGAAGG + Intergenic
1042866764 8:73363287-73363309 GTTCATACCTGACCCAAGGATGG - Intergenic
1043098220 8:76003845-76003867 ATTCAAACGACATAAAAGGAAGG - Intergenic
1047398644 8:124527408-124527430 GTCAAAACCACAAAAAAGGAGGG + Intronic
1048704906 8:137142785-137142807 GTCGAAACCACAAAAAAGGAAGG - Intergenic
1052264618 9:26557687-26557709 GTTCTTACCACAAAAAAGGAAGG + Intergenic
1052618362 9:30872628-30872650 GTTAAAACCAAAACAAAGAATGG - Intergenic
1054457193 9:65439283-65439305 CTTCAAACCACCACAAATGAAGG + Intergenic
1054818212 9:69496075-69496097 GTTCAGACCAGACCAGAGAAAGG + Intronic
1055824195 9:80304305-80304327 GTTCAAACCTCAATTAAGGATGG - Intergenic
1057958788 9:99434701-99434723 GTTCAAACCAAATCAGAGGAGGG + Intergenic
1058903677 9:109463077-109463099 GTTCACACCACACAGAAGGGCGG + Intronic
1059096075 9:111416201-111416223 GATCACACCACACCCAAAGAGGG - Intronic
1059464686 9:114460518-114460540 CTTCAAACCCCACCAAAGAATGG - Intronic
1187194262 X:17067406-17067428 GTTCTCACCACACCAAAAAAAGG - Intronic
1189008677 X:37022397-37022419 GTTGAAAGCACACCAAAGTGAGG + Intergenic
1193491719 X:82158229-82158251 CTCCAAACCAGACCAAAGAAAGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1198482201 X:137051724-137051746 ATTCAAAGCACACCAGAGAAAGG + Intergenic
1201278291 Y:12318550-12318572 GCTCCAACCACACCAGAGGCTGG + Intergenic
1201573166 Y:15434765-15434787 GCTCTAACCACACCAGAGGGTGG + Intergenic