ID: 949756606

View in Genome Browser
Species Human (GRCh38)
Location 3:7418614-7418636
Sequence GAGACTTGCCAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949756596_949756606 15 Left 949756596 3:7418576-7418598 CCCTACCCACAGCCCACCAGCTG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756600_949756606 3 Left 949756600 3:7418588-7418610 CCCACCAGCTGAGTGTGTTCACC 0: 1
1: 0
2: 1
3: 13
4: 127
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756601_949756606 2 Left 949756601 3:7418589-7418611 CCACCAGCTGAGTGTGTTCACCC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756599_949756606 9 Left 949756599 3:7418582-7418604 CCACAGCCCACCAGCTGAGTGTG 0: 1
1: 1
2: 2
3: 24
4: 251
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756595_949756606 16 Left 949756595 3:7418575-7418597 CCCCTACCCACAGCCCACCAGCT 0: 1
1: 0
2: 4
3: 49
4: 524
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756598_949756606 10 Left 949756598 3:7418581-7418603 CCCACAGCCCACCAGCTGAGTGT 0: 1
1: 1
2: 3
3: 72
4: 4818
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756602_949756606 -1 Left 949756602 3:7418592-7418614 CCAGCTGAGTGTGTTCACCCTTG 0: 1
1: 0
2: 1
3: 14
4: 206
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208
949756597_949756606 14 Left 949756597 3:7418577-7418599 CCTACCCACAGCCCACCAGCTGA 0: 1
1: 0
2: 3
3: 38
4: 418
Right 949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949756606 Original CRISPR GAGACTTGCCAGGATGCTGC TGG Intronic
900762798 1:4484058-4484080 GTGCCTGGCCAGGATGCTCCTGG + Intergenic
901858317 1:12058228-12058250 GAGACTTGACAGGGTGATGCTGG - Intergenic
902627228 1:17683607-17683629 GAGACATGCCAGGCTGGGGCTGG + Intronic
903670175 1:25030885-25030907 GAGACTGGCCAGGGTGGGGCTGG - Intergenic
903755439 1:25657359-25657381 CAGCCTGGCCAGGATGCAGCTGG + Intronic
905217158 1:36416915-36416937 CAGACTTTGCAGGATGCAGCAGG - Intronic
905501716 1:38444976-38444998 GAGACTTGTCAGGACACAGCTGG + Intergenic
905518737 1:38581236-38581258 GAGACTTCCCTGGATTCAGCTGG + Intergenic
905936575 1:41828775-41828797 GAGACTGGCCAGGGTGCAGGGGG - Intronic
907916569 1:58875222-58875244 GAGCCGTGCCAGGTTGCTGCGGG + Intergenic
912336546 1:108867947-108867969 GATACTTGCTAGCATGCTGGAGG - Intronic
915448196 1:155986722-155986744 GAGACATGCAAAGATGCTGATGG + Intronic
917271943 1:173285643-173285665 GAAACTTGCCTGGATGTTGATGG - Intergenic
917495741 1:175538628-175538650 GAGACTGTCCAGGGTGCTGGAGG + Intronic
920033989 1:203053908-203053930 GACCCTGGCCATGATGCTGCAGG + Exonic
921264543 1:213411462-213411484 CAGACTTGCCAGGGTGGAGCGGG + Intergenic
922478186 1:225921350-225921372 GGGAGCTGCCAAGATGCTGCTGG - Exonic
1062840381 10:666026-666048 GGGCCTTTCCAGGGTGCTGCCGG - Intronic
1063122213 10:3113149-3113171 GCGACTTGCCATCAAGCTGCCGG + Exonic
1065700217 10:28417845-28417867 GGGTCTTGCCAGGATGCTGATGG - Intergenic
1067161275 10:43826672-43826694 GGGACTGGACAGGAGGCTGCAGG - Intergenic
1067214599 10:44292366-44292388 CAGACTGGCCAGGAGACTGCAGG + Intergenic
1074560006 10:114527202-114527224 GGGACTTGCGAGGAGGCTGCAGG - Intronic
1076030332 10:127152445-127152467 GTGCCATGCCAGGCTGCTGCAGG + Intronic
1076881995 10:133244166-133244188 GAGACTATCCAGGAAACTGCAGG + Intergenic
1078430381 11:11283593-11283615 GAGACTGGGCCGGAGGCTGCAGG - Intronic
1078433410 11:11304844-11304866 GCTCCTTTCCAGGATGCTGCAGG - Intronic
1078900990 11:15642683-15642705 GAGAATCCCCAGGATGCTGTAGG - Intergenic
1079999532 11:27332022-27332044 GAGCCCTTCCAGGATTCTGCAGG - Intronic
1082247239 11:49938717-49938739 AAGACTTGCACGGATGCTCCTGG - Intergenic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1087023453 11:93626347-93626369 GAGTCTTGCCTGGATGTTGATGG + Intergenic
1087418974 11:97896638-97896660 GAGCCTTGCCAAGAGGTTGCAGG - Intergenic
1087826856 11:102774833-102774855 AAGAATAGCCAGGATGCTCCTGG - Intronic
1088540057 11:110904080-110904102 GAGCTTTGCCAGGAGCCTGCTGG + Intergenic
1094058132 12:26286737-26286759 GAAACTTCCCAGGGTCCTGCTGG - Intronic
1094063135 12:26335811-26335833 GTGACTTGCCAAGCTCCTGCAGG + Intergenic
1094208110 12:27861916-27861938 GTGACTTCCCAGAATGCTGCTGG + Intergenic
1096896056 12:54821590-54821612 GAGAGTTGCCATGATGGTGAGGG + Intergenic
1096977010 12:55705242-55705264 GGGACTAGAGAGGATGCTGCTGG - Intronic
1101998379 12:109541191-109541213 GAGACAGGCTAGGATCCTGCAGG + Intergenic
1105617975 13:22038103-22038125 AGGACTTGCAAGGATACTGCTGG - Intergenic
1106022499 13:25928884-25928906 GAGACCTGACAGGATGCCACGGG + Intronic
1106606234 13:31231792-31231814 GAGAGTTGGCAGGCTGTTGCTGG + Intronic
1108515365 13:51196844-51196866 GAGACTCCCCAGGAAGCTGCTGG + Intergenic
1109058266 13:57580854-57580876 CTGACTAGCCAGGATGTTGCAGG + Intergenic
1109087658 13:57996615-57996637 GAGAAATGCCATGATGATGCAGG - Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1121244232 14:92450832-92450854 GAGACCTCCCAGGACCCTGCAGG + Intronic
1121952460 14:98183625-98183647 GAGAACTGCCAAGATGCAGCAGG + Intergenic
1122874256 14:104656287-104656309 GTGACTTGCCAGCATCCCGCCGG + Intergenic
1123028595 14:105440062-105440084 CAGACCTCCCAGGAAGCTGCGGG - Intronic
1123412350 15:20071232-20071254 GCTACTTGCCAGGCTGATGCAGG + Intergenic
1123413688 15:20080068-20080090 GCTACTTGCCAGGCTGATGCAGG + Intergenic
1123521692 15:21078352-21078374 GCTACTTGCCAGGCTGATGCAGG + Intergenic
1123523030 15:21087180-21087202 GCTACTTGCCAGGCTGATGCAGG + Intergenic
1124013567 15:25858963-25858985 GTGCCTTGCAAGGGTGCTGCTGG - Intronic
1124688279 15:31800479-31800501 GGGACTCCCCAGGATGCTGTGGG + Intronic
1128085364 15:64882734-64882756 GTGACCTGCCAGAATCCTGCAGG - Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128790004 15:70426235-70426257 GACACTGGCCATGGTGCTGCTGG - Intergenic
1130584547 15:85170941-85170963 GAGACATGCCAGGATGCCAGTGG - Intergenic
1130693921 15:86111090-86111112 GAGAATTGCCTGGAGGCAGCTGG + Intergenic
1131009795 15:89007727-89007749 GATACTTGGCAGGATGAGGCGGG - Intergenic
1132258610 15:100401311-100401333 GAGACTTCTCAGGTGGCTGCTGG - Exonic
1133764663 16:8829554-8829576 GAGCCTTGCCAAGTTGATGCTGG - Intronic
1136066559 16:27762771-27762793 GTGACTTGCCAGGATGTTGGGGG - Intronic
1136178219 16:28533171-28533193 CTGAGTTACCAGGATGCTGCTGG - Intronic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1139508244 16:67410325-67410347 GAGCCTTGCAAAGATGCAGCTGG - Intronic
1139587311 16:67912347-67912369 CACACTTGCCATGATGATGCTGG - Intronic
1143103281 17:4515481-4515503 GAGAATTGCCAGCATTCTGAGGG + Intronic
1144447282 17:15342500-15342522 GGGACTTGCCAGGATAAGGCAGG + Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1148518923 17:48249992-48250014 GAGACTGGATAGGATGCTTCAGG - Intronic
1148594617 17:48843600-48843622 GATACTTGCCAGTGTCCTGCTGG - Intronic
1149601815 17:57898322-57898344 GGGTCTGGCCAGGAAGCTGCCGG + Intronic
1150012555 17:61518977-61518999 CAAACTTGCCGGGAAGCTGCAGG + Intergenic
1150024575 17:61659242-61659264 GAGATTTTCCAGGTAGCTGCAGG + Intergenic
1150208371 17:63426706-63426728 CTGACTTGCCAGGCTGCCGCTGG + Exonic
1150551711 17:66216665-66216687 CAGACTTGCTAGGAAACTGCTGG - Intronic
1151722507 17:75865477-75865499 GAGACCAGCCAGGGCGCTGCAGG - Intergenic
1151960593 17:77403427-77403449 GAGCCCTCCCAGGACGCTGCTGG - Intronic
1151963912 17:77421400-77421422 AAGACTGGGCTGGATGCTGCTGG + Intronic
1152338847 17:79713440-79713462 GAGACTCCCCAGGATCATGCAGG + Intergenic
1152665331 17:81565381-81565403 GGCACCTGCCAGGATGCAGCTGG + Intronic
1158067742 18:53433372-53433394 GACATTTGCCAGGCTGCTGGAGG + Intronic
1159276757 18:66232051-66232073 GAGAGTCCCCAGGAGGCTGCTGG - Intergenic
1160165932 18:76512462-76512484 GGGACTTGCCTGGAGGCTGACGG + Intergenic
1160431963 18:78818986-78819008 GAGACTGGCCAGGGAGATGCAGG + Intergenic
1161945913 19:7436677-7436699 CAGCCCTGCCAGGATGCTGCTGG + Intronic
1162828758 19:13270875-13270897 GGCACTTGCCAGGATCCTACTGG + Intronic
1163125631 19:15242960-15242982 GAGGCTTGGCAGGCTGCGGCGGG + Exonic
1164677539 19:30111814-30111836 GGCACTTGCCAGGATCCAGCGGG - Intergenic
1164711596 19:30360693-30360715 CCGACTTCCCAGGATTCTGCTGG + Intronic
1164783935 19:30914452-30914474 GAAGCCTGCCAGGGTGCTGCTGG + Intergenic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167226996 19:48251813-48251835 GAGACTGGCCATGTTGATGCTGG - Intronic
1167882140 19:52468890-52468912 GAGATATCCCAGGAAGCTGCTGG - Intronic
1168407589 19:56119019-56119041 GAGATTTGCCAGAGTGCTCCCGG - Intronic
925024252 2:595235-595257 GATGCTTGCCAGGAGGCTGGGGG + Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
926763730 2:16303856-16303878 GACACCTGCTAGGATGCTACAGG - Intergenic
934129264 2:88931806-88931828 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
934145086 2:89085332-89085354 GAGCCTGGCCAGGTTTCTGCTGG + Intergenic
934150380 2:89142729-89142751 GAGCCTGGCCAGGTTTCTGCTGG + Intergenic
934159427 2:89234340-89234362 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
934166050 2:89295355-89295377 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
934201226 2:89887101-89887123 GAGACTGGCCTGGCTTCTGCAGG - Intergenic
934224169 2:90115223-90115245 GAGCCTGGCCAGGTTTCTGCTGG - Intergenic
934230230 2:90173235-90173257 GAGCCTGGCCAGGTTTCTGCTGG - Intergenic
934518029 2:95001118-95001140 GAGAATTGGCTGGAAGCTGCAGG + Intergenic
934779437 2:96960430-96960452 TTGCCTTGCCAGGATGCTGGTGG - Exonic
934789974 2:97050850-97050872 GAGACTGGCCTGGCTTCTGCAGG - Intergenic
934816494 2:97331689-97331711 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
934821202 2:97376795-97376817 GAGACTGGCCTGGCTTCTGCAGG - Intergenic
935925590 2:108065181-108065203 GAAACTTTCCAGGAAGCAGCTGG + Intergenic
936158871 2:110069252-110069274 GAGAATTGGCTGGAAGCTGCAGG - Intergenic
936185789 2:110302080-110302102 GAGAATTGGCTGGAAGCTGCAGG + Intergenic
937243518 2:120477581-120477603 GAAACCTCCCAAGATGCTGCAGG - Intergenic
938374834 2:130798362-130798384 GAGACTTGGAACGATGGTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942822254 2:180128107-180128129 GAGTCTTGCCTGGATGTTGATGG + Intergenic
946403426 2:219480720-219480742 TAGACCTGCCAGGAGACTGCTGG - Intronic
946688832 2:222295848-222295870 GAGGCTTCCCAGGCTGCTCCGGG - Intronic
948932678 2:241142085-241142107 GAGAGTGCCCAGGATACTGCAGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172046187 20:32082005-32082027 GAGACTGGCTTGGTTGCTGCTGG - Intronic
1173492626 20:43495510-43495532 GAGAGCCCCCAGGATGCTGCTGG + Intergenic
1174578250 20:51552967-51552989 GGGCCTTGCCAGGAAGGTGCGGG - Intronic
1175619776 20:60433580-60433602 AAGAGATGCCAGGATGATGCAGG + Intergenic
1177139065 21:17339392-17339414 GAGACTTGCCATTTTTCTGCAGG + Intergenic
1178879168 21:36434939-36434961 GGGACTTGGCAGGATGGTGGGGG - Intergenic
1180588406 22:16914392-16914414 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
1180589175 22:16921600-16921622 GAGACTGGCCTGGCTTCTGCAGG + Intergenic
1182723895 22:32427042-32427064 GAGAATTTCCAGGAGACTGCTGG + Intronic
1183187123 22:36298588-36298610 GAGACTTCCTAGGAGGCTCCGGG - Intronic
1183326004 22:37194714-37194736 GAGCCTTGCCAGGTTGATGTTGG - Intronic
1183492394 22:38123521-38123543 GAGACTGGCCGAGATCCTGCTGG - Intronic
1184687265 22:46102301-46102323 GACCCTTGCCGGGATGGTGCCGG + Intronic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
952900697 3:38109864-38109886 GAGCCATGCCAGCATGCCGCTGG + Intronic
952991541 3:38835240-38835262 AAGACTTGCCCGGGGGCTGCAGG + Intergenic
953714042 3:45300838-45300860 GAGAGTTGCCAGCTGGCTGCTGG - Intergenic
953925452 3:46980270-46980292 GAGACTGGCCAGGAGGCTAGGGG + Intronic
954941333 3:54375798-54375820 GACACTTGTTAGGATGCTGAGGG + Intronic
955033385 3:55242261-55242283 GAGAGTTGTCAGCATGCAGCTGG + Intergenic
956165314 3:66394124-66394146 GCTAATTGGCAGGATGCTGCAGG - Exonic
957085769 3:75675230-75675252 GAGACTGGAAAGGAGGCTGCAGG + Intergenic
959904291 3:111693481-111693503 GTGACTTGCAAGGATGAGGCAGG - Intronic
959912231 3:111776513-111776535 TAAACTTTCCAGGATGCTGCAGG - Intronic
961318348 3:126055863-126055885 GGGCCACGCCAGGATGCTGCGGG + Intronic
962247905 3:133812853-133812875 GAGAATTACCAGGATGCTTATGG + Intronic
963291776 3:143497551-143497573 GATGCTGGCCAGGAAGCTGCTGG + Intronic
965136659 3:164781127-164781149 GAGACCTGCCATGATTGTGCTGG - Intergenic
966929516 3:184666795-184666817 GAGCCTTGCCAGGATGTAGACGG - Intronic
967271620 3:187737904-187737926 GTAACTTTCCAGGAAGCTGCCGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969619480 4:8271920-8271942 GAGACTGCCCAGGAGGCTGAGGG + Intronic
971196278 4:24473304-24473326 AAGGCTTGCCAGGAGGTTGCCGG - Intergenic
973658251 4:53073900-53073922 GAGACTTGCCTTGATGTTGATGG + Intronic
975754254 4:77557334-77557356 TACACTTGCAAGGCTGCTGCAGG + Intronic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
977688109 4:99872431-99872453 GAGTCTTGCCTGGATGGTGATGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
983794702 4:171847379-171847401 GAGACTTGCCTCGATGTTGATGG + Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
986720188 5:10555532-10555554 CAGACCTGCCAGGATGCCTCGGG - Intergenic
987095363 5:14544930-14544952 GACACTTGCCAGGAGGCTGAAGG + Intergenic
988047989 5:25984377-25984399 GATACCTGCATGGATGCTGCTGG - Intergenic
988936007 5:36083438-36083460 GAGAGTTGCCAGATTGCTACTGG - Intergenic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
993991724 5:94665917-94665939 GAGACTTCCAAGGAGGATGCAGG - Exonic
994033797 5:95175784-95175806 CACACCTGCCAGGATGTTGCTGG + Intronic
994190431 5:96863088-96863110 GAGACTTGAGAGGATAGTGCAGG - Intronic
996508072 5:124289683-124289705 CTGACTTGCCAGGATCTTGCTGG + Intergenic
999190789 5:149745754-149745776 GTGACTTGGTAGGATCCTGCCGG + Intronic
1000253812 5:159519444-159519466 CAGTTTGGCCAGGATGCTGCAGG + Intergenic
1002556610 5:180046524-180046546 GAGAATTGTCAGTCTGCTGCAGG + Intronic
1004243650 6:13951932-13951954 GAGCCTTGCCAGGTTGATGCTGG - Intronic
1005347988 6:24909320-24909342 GAGAATAGCCATGATGGTGCTGG + Intronic
1005758142 6:28943891-28943913 GATCCTGGACAGGATGCTGCAGG + Exonic
1006259245 6:32854217-32854239 GTGCCTTGCAGGGATGCTGCGGG + Exonic
1006525228 6:34598898-34598920 GGGACTTGCCAGGATACTCTGGG - Intronic
1007685447 6:43664836-43664858 CAGACTTGTCAGGAGGCTGAGGG + Intronic
1009583467 6:65566308-65566330 GTGACTTGCCAGTATACTGGAGG - Intronic
1016634452 6:146271426-146271448 GAGACTTGTTAGGAAGCTGGTGG + Intronic
1017381002 6:153829615-153829637 TAGACATTCCAGGAGGCTGCTGG - Intergenic
1019167398 6:170107796-170107818 GAGACTTGCCGGAAAGATGCAGG + Intergenic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019232629 6:170581037-170581059 GAGACTTGGCAGGAGGCAGTAGG - Intronic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1020898863 7:13977049-13977071 GAGAAATGCCTGGATGCTGATGG - Intronic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1021892424 7:25198877-25198899 GAAACTTGCCAGGGTGCAGGCGG + Intergenic
1024577893 7:50779901-50779923 GAGACTTGCCTGAAGGCAGCTGG - Intronic
1025078735 7:55964677-55964699 GAGCCTGGGCAGGAGGCTGCAGG - Exonic
1026988799 7:74571330-74571352 GAGACTGGCCAGGATGGAGCGGG + Intronic
1028737991 7:94239811-94239833 GAGACTTGTCAGCTTGCTCCTGG - Intergenic
1031805440 7:126301697-126301719 CATAATTGCCAGGATGATGCAGG - Intergenic
1033330665 7:140414459-140414481 GACAGATGCCAGGATGTTGCAGG + Intronic
1034866126 7:154643982-154644004 GTGCCCTGCCAGGCTGCTGCTGG + Intronic
1035673989 8:1442186-1442208 TAGACCTGCCAGGCTGCTGATGG + Intergenic
1035674015 8:1442296-1442318 TAGACCTGCCAGGCTGCTGATGG + Intergenic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1040425523 8:47281235-47281257 GAGTCTTGCCTTGATGCTGATGG + Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041838929 8:62248038-62248060 GGGACTAGCCAGGACGCCGCGGG - Intergenic
1042982819 8:74549446-74549468 AAGACTGTCCAGGATGCTTCAGG + Intergenic
1043150500 8:76708551-76708573 GAGACTTCCAAGGATGCTAAGGG - Intronic
1043229877 8:77788380-77788402 GGGACTTGCCAAGTTGCTACTGG + Intergenic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1047295040 8:123563208-123563230 GAGTCTAGTGAGGATGCTGCTGG + Intergenic
1059730630 9:117053599-117053621 GAGAAGAGCCAGGATGTTGCTGG - Intronic
1060856193 9:126915761-126915783 GGGGCTTGCCAGGATGCGGGGGG + Intronic
1061082471 9:128380174-128380196 GAGATTTGGCAGGATTCTTCTGG + Intronic
1061363049 9:130155874-130155896 GAGCCTTTGCAGGATCCTGCGGG - Intergenic
1062212348 9:135371942-135371964 GGGACTTGCCAGGACCCTGGAGG - Intergenic
1185778554 X:2825831-2825853 GAGAAATGCCAGGATGAAGCTGG - Intergenic
1186336973 X:8599676-8599698 CAAACCTGCCAGCATGCTGCTGG + Intronic
1186830713 X:13387370-13387392 GAGACTTCCCTGGATTCTCCTGG - Intergenic
1187024301 X:15417876-15417898 GAGATTAGCCTGGATGATGCAGG - Intronic
1192152252 X:68719517-68719539 GAGATATGCCAGGAGGCTGGAGG + Intronic
1199927704 X:152485567-152485589 GAGACTTGGCAGGATCCAGTTGG - Intergenic