ID: 949761055

View in Genome Browser
Species Human (GRCh38)
Location 3:7471433-7471455
Sequence GTTTCTCTGCTGACAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949761049_949761055 5 Left 949761049 3:7471405-7471427 CCTGTTTGGTTTTGGGACTGAGG 0: 1
1: 0
2: 4
3: 15
4: 177
Right 949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG 0: 1
1: 1
2: 1
3: 6
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949761055 Original CRISPR GTTTCTCTGCTGACAGTGGT GGG Intronic
901170486 1:7253427-7253449 ATCTCTCTGCTGAGAGTGCTGGG + Intronic
901327031 1:8373038-8373060 TCTGCTCAGCTGACAGTGGTAGG - Intronic
902026602 1:13388793-13388815 GCTACTCTGCAGACAGAGGTGGG - Intergenic
902226706 1:15000722-15000744 GTTTCTCTGCTGAAAAAGGCAGG + Intronic
904394953 1:30213876-30213898 ATTTCTCTGCTGAGATGGGTAGG - Intergenic
905483796 1:38281390-38281412 GTTTATCTGCTGAGAGTGAGGGG + Intergenic
907097140 1:51792126-51792148 GTTTCTCTGCTGGGAGGAGTTGG - Intronic
911669777 1:100594567-100594589 TTTTCTCTCCTGACAGTTTTTGG + Intergenic
912970073 1:114272850-114272872 ATTTATCTGCTGGCAGTGCTGGG - Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
913968430 1:143395566-143395588 GTTTCTCTGCTCACAGAGTGAGG + Intergenic
914062808 1:144221162-144221184 GTTTCTCTGCTCACAGAGTGAGG + Intergenic
914116342 1:144745192-144745214 GTTTCTCTGCTCACAGAGTGAGG - Intergenic
915342675 1:155184989-155185011 GTTTCTGTGCTGGGTGTGGTAGG + Intronic
916833772 1:168520576-168520598 CTTTCTCTGCAGTCAGTTGTGGG + Intergenic
917509110 1:175655680-175655702 GTTTCTTTGCTAATGGTGGTGGG - Intronic
918151829 1:181803563-181803585 GCTTCTCTGCTGTCTGTGGAGGG + Intronic
918208967 1:182334058-182334080 TTTTCTCTTCTGACAGTTGGTGG - Intergenic
918786355 1:188769155-188769177 GGTTTTCTCCTGACAGTGCTAGG + Intergenic
919133435 1:193479344-193479366 ATATCACTGGTGACAGTGGTTGG + Intergenic
920774769 1:208925207-208925229 GTTTCTCTGCTGACATGTGCAGG + Intergenic
920951575 1:210576013-210576035 GCTTCTCTGCAGCCAGTGTTAGG + Intronic
920960149 1:210656607-210656629 GGTTCTCTGCTGACGGTGAGCGG - Intronic
921790942 1:219289887-219289909 GTTTCTCTGATGAAAAAGGTAGG - Intergenic
1063644954 10:7870415-7870437 GTTTCTTTTCTTCCAGTGGTCGG + Intronic
1070535841 10:77376529-77376551 GTTGCTCTTCTGATATTGGTAGG - Intronic
1072654569 10:97320901-97320923 GTCTCTCTTCTCAGAGTGGTGGG + Exonic
1074360917 10:112823615-112823637 GTTTCTCTGCTGTCTGGGGGAGG - Intergenic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076808132 10:132869667-132869689 GCTTCTCTGCTTATTGTGGTGGG - Intronic
1077947779 11:6921149-6921171 ATTTATCTGCTGACCGTGCTTGG + Exonic
1079742890 11:24086072-24086094 GTGTCTCTGTTGATAATGGTGGG - Intergenic
1083415349 11:62521950-62521972 GTTTCTCTGCCCAAAGTGGAAGG - Exonic
1083416075 11:62526600-62526622 GTTTCTCTGCCCAAAGTGGAAGG - Exonic
1087976059 11:104548317-104548339 GTTTCTCTACTGACTATTGTAGG + Intergenic
1090427829 11:126621945-126621967 TGTTGGCTGCTGACAGTGGTGGG + Intronic
1091467347 12:696747-696769 TTTTCTCTGAAGGCAGTGGTTGG - Intergenic
1091722507 12:2823712-2823734 GTTTCAGTGCCGACAGTGGGGGG - Intronic
1092148128 12:6228841-6228863 GTTGCTCTGCAGACAGTTGGTGG - Intronic
1096680822 12:53254087-53254109 ATGGCTCTGCTGGCAGTGGTGGG + Exonic
1097429450 12:59486537-59486559 GCTGTTCTCCTGACAGTGGTTGG + Intergenic
1100612644 12:96204092-96204114 GTTACTATACTGAGAGTGGTCGG + Intronic
1101012429 12:100464861-100464883 GCTTATCTGCTGGGAGTGGTGGG + Intergenic
1101386641 12:104264143-104264165 TTTTCTCTCCTGCCAGTGCTTGG - Intronic
1102613693 12:114134548-114134570 GTTTCCCTGCTGCTAGGGGTGGG - Intergenic
1104206495 12:126643531-126643553 GTTTCTCTGGTCCCAGTGGTTGG + Intergenic
1106640384 13:31578502-31578524 GTTTCTCTGGTGATAAGGGTGGG + Intergenic
1108007897 13:45970961-45970983 GTTTCTCATCTGAAAATGGTGGG + Intronic
1112852252 13:103720638-103720660 GTTGCTCTGCTAACATGGGTGGG + Intergenic
1113353063 13:109548524-109548546 GTGTCTGTGCTGACGTTGGTTGG - Intergenic
1120790076 14:88572605-88572627 GTTTCACTGTTGACATTAGTCGG - Exonic
1121177051 14:91898415-91898437 GTGTGTAAGCTGACAGTGGTTGG - Intronic
1121896074 14:97649120-97649142 TTTTCTCTGTTTTCAGTGGTTGG - Intergenic
1124883299 15:33661525-33661547 GTTTTTCCACAGACAGTGGTGGG + Intronic
1125681094 15:41530660-41530682 CTCTCTCTGCTCACAGTGCTGGG - Intronic
1126029805 15:44485407-44485429 GTTTTTCCACTGACAGTGATGGG + Intronic
1127311062 15:57752728-57752750 GTGTCTCTGCACACAGTGGGCGG + Intronic
1129234741 15:74217403-74217425 GGTTCTCTGCTGACAGTCTCAGG - Intergenic
1129387971 15:75206420-75206442 GTTTGGGTGCTGCCAGTGGTGGG - Exonic
1130253135 15:82313725-82313747 ATGTCTCTCCTGTCAGTGGTGGG + Intergenic
1130932586 15:88440290-88440312 ATTCCCCTGCTGACAGTGATTGG - Intergenic
1132323235 15:100942845-100942867 GCCTCTCTGCTCACAGTGGGCGG + Intronic
1132465049 16:73535-73557 ATTTCTCTCCTGACACTGGGTGG + Intronic
1134033980 16:11015576-11015598 GCTCATCTGCTGACTGTGGTGGG + Intronic
1135460148 16:22635152-22635174 GATTCTCTGCAGAGAGTGCTGGG + Intergenic
1135650382 16:24201332-24201354 GTTTCCCTGCTGGCATTGTTTGG - Intronic
1140206954 16:72940800-72940822 GTTTATCTACTGATAGTGTTTGG - Intronic
1147982574 17:44283591-44283613 GTCTCTCAGCTGACAGCGCTGGG - Intergenic
1148368527 17:47075075-47075097 GTTTCTGTTCTGTCAGAGGTAGG - Intergenic
1148755540 17:49971296-49971318 ATTTCTCTGCTGGAACTGGTGGG + Intronic
1149633293 17:58143814-58143836 GCTTCTCTAGTGACACTGGTTGG + Intergenic
1150486823 17:65549869-65549891 GTTCCTCTGCCCCCAGTGGTGGG + Intronic
1150677874 17:67260494-67260516 GTTTGTTTGATCACAGTGGTCGG + Intergenic
1152662942 17:81551412-81551434 GGTTCTATGCTGACAGGTGTCGG - Intronic
1152760612 17:82105407-82105429 GGTGCCGTGCTGACAGTGGTGGG - Intronic
1155014250 18:21816962-21816984 GTTCATCTGTTGAGAGTGGTGGG + Intronic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1157871814 18:51236461-51236483 GTTTCTGGCCTGTCAGTGGTTGG - Intergenic
1159800994 18:72899010-72899032 CTCTCTCGGCTGACAGTGGAGGG - Intergenic
1160474359 18:79168812-79168834 GTTTCTCCCCTGACAGTCTTTGG + Intronic
1161567381 19:5011299-5011321 TTTTCTCTGCTGACAGGGCTTGG + Intronic
1163360281 19:16841679-16841701 GTTCCTGTGCAGACAGTGGCTGG + Intronic
1164147712 19:22522342-22522364 CTTTCTCTGCTGACAGCTTTGGG + Intronic
1164158892 19:22613748-22613770 GTTTCTCTGCTGACAGCTTTGGG - Intergenic
1164770503 19:30804803-30804825 CTTTCTCTGTTAACAGTTGTAGG - Intergenic
1164810773 19:31154151-31154173 GTAGCTCTGCTGTCAGTGTTTGG - Intergenic
1165285947 19:34841729-34841751 GTGTCAATGCTGACAGTTGTTGG - Intergenic
1166726480 19:45031434-45031456 TTTTCTCTGCTGACTGTGCCTGG + Intronic
1202702218 1_KI270712v1_random:173034-173056 GTTTCTCTGCTCACAGAGTGAGG + Intergenic
925364003 2:3298783-3298805 GTGAGTCTTCTGACAGTGGTTGG - Intronic
925408425 2:3624621-3624643 GTTGCTCAGCTTACAGTTGTGGG + Intronic
926487027 2:13474634-13474656 CTTTGTCAGCTGACAGTTGTAGG + Intergenic
926502809 2:13676325-13676347 ATTTGTCTGCTTACAGTGCTTGG - Intergenic
926655256 2:15397253-15397275 GTTTCTCAGTTGAGAGTGTTTGG - Intronic
927631992 2:24782403-24782425 GTTTATCTTCTGCCACTGGTTGG - Intergenic
930313018 2:49765918-49765940 ATTTGTCTGCTGACATTGGAAGG - Intergenic
930416426 2:51095772-51095794 GTTTCTCTGGAGGCAGTGTTGGG - Intergenic
931170997 2:59803657-59803679 GTTCCTCTTCTGTCAGTGGCAGG - Intergenic
931319977 2:61166614-61166636 GTTCCTCTGGTGACTGAGGTGGG - Intergenic
931384144 2:61782009-61782031 GTTTTTCTTTTAACAGTGGTTGG - Intergenic
934173134 2:89556481-89556503 GTTTCTCTGCTCACAGAGTGAGG + Intergenic
934283450 2:91630838-91630860 GTTTCTCTGCTCACAGAGTGAGG + Intergenic
934622705 2:95825125-95825147 GCTTCTTTGCTGACAGAAGTAGG + Intergenic
934723077 2:96595457-96595479 GTTTCTCTGAAGACAGTTGGCGG + Exonic
934811072 2:97276978-97277000 GCTTCTTTGCTGACAGAAGTAGG - Intergenic
934826620 2:97430961-97430983 GCTTCTTTGCTGACAGAAGTAGG + Intergenic
935092184 2:99905878-99905900 GATTCTCTGATGGCAGTGGAGGG - Intronic
938288658 2:130138117-130138139 GATTCTCTGCTCACAGTTTTGGG + Intergenic
938426916 2:131200676-131200698 GATTCTCTGCTCACAGTTTTGGG - Intronic
938467875 2:131534815-131534837 GATTCTCTGCTCACAGTTTTGGG - Intergenic
938617365 2:133013155-133013177 CTTCCTCTGCCAACAGTGGTGGG + Intronic
938962924 2:136359182-136359204 CTTGCTCTGCAGACAGAGGTGGG + Intergenic
939562114 2:143744313-143744335 GTTATTCTACTGACAGTGTTTGG + Intronic
941438509 2:165503502-165503524 GTTTTTCTGTTAATAGTGGTGGG - Intronic
941701782 2:168611287-168611309 GTTTCTATGCTGATAATGCTGGG - Intronic
941890530 2:170576414-170576436 GTTGCTGTGGTGACCGTGGTAGG + Intronic
944756621 2:202769182-202769204 TTTTCTTTGCTTTCAGTGGTTGG + Exonic
945989700 2:216384940-216384962 GTCTCTATGTTGACAGTGGCTGG - Intergenic
946392396 2:219424386-219424408 GTTTCTCTGCTCTCTGGGGTTGG - Intronic
948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG + Intronic
948546234 2:238730687-238730709 CTTCCACTGCTGACAGTGCTGGG + Intergenic
1169270452 20:4195357-4195379 GCTTCCCTGCAGACAGTGGCAGG + Intergenic
1169366879 20:4999852-4999874 GTTTCTTTGCTTAGAGTGGAGGG - Intronic
1170396299 20:15929398-15929420 TATTCTCTGCTCACAGTGGGAGG + Intronic
1175304371 20:57965803-57965825 GTTCCTCTGGCCACAGTGGTAGG + Intergenic
1175737398 20:61396685-61396707 GTTTCTCGGCTCACAGTTCTGGG + Intronic
1178586946 21:33878731-33878753 GTTGCTCTGCTGTCAGTGGGTGG + Intronic
1181903630 22:26175537-26175559 GTTTCTGTCCTGTCAGTGTTTGG - Intronic
1181935125 22:26432824-26432846 GTTGCCCTTCTGACAGAGGTTGG - Intronic
1182005866 22:26959185-26959207 AAATCACTGCTGACAGTGGTGGG - Intergenic
949747174 3:7308439-7308461 GGTTCTTTGCTGAAAGTTGTAGG + Intronic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
953602976 3:44386563-44386585 GCTTCTGAGCTGACAGGGGTGGG - Intronic
953982903 3:47421537-47421559 TTTTGTCTGCTGACAGAGCTTGG - Intronic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
955292954 3:57709331-57709353 GCTTCTCTTCTAACAGAGGTAGG - Intergenic
955935834 3:64101687-64101709 CTTACTCTACTGACAGCGGTTGG - Intronic
958715809 3:97779008-97779030 GTTTTTCTGATGAAAGTGCTAGG + Intronic
960949827 3:122992170-122992192 TTTTCTTTGCAAACAGTGGTGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962419215 3:135213628-135213650 TTTTATCAGCTGACATTGGTGGG + Intronic
962968713 3:140379236-140379258 GTTTCTCTGCTGACAGTGTTGGG + Intronic
963528993 3:146449830-146449852 GTTTTCCTACTGACAGTGGGTGG - Intronic
964627017 3:158769407-158769429 GTTTCTCTGATGAGAATGGCTGG - Intronic
964743092 3:159988059-159988081 CTTTCTGTGCTGAGAGTAGTGGG - Intergenic
965067659 3:163872988-163873010 GTTGCTCTGTTGAAAGTGTTCGG - Intergenic
965619900 3:170632956-170632978 TTTTCTCTGCACACAGGGGTTGG - Intronic
967097440 3:186188509-186188531 ATTTCTCTTCTGACAGTGGCAGG - Intronic
967462044 3:189758780-189758802 GTTCCACTGCTGACACTGGCAGG + Intronic
971524876 4:27604257-27604279 GTTGCTCTTCTGACTGTGGCTGG - Intergenic
977364268 4:96047149-96047171 TTTTCTCTGCTGTAAATGGTGGG + Intergenic
982281493 4:153687901-153687923 GTTTCTCTTTTAACAGTGTTTGG + Intergenic
982339026 4:154274135-154274157 TTTTCCCTGCTGACAGCGATAGG - Intronic
984153317 4:176161849-176161871 GCTTCTTTTCTGACAGTTGTGGG + Intronic
984443634 4:179805434-179805456 TTTTCTCTTCTTACAGTGTTTGG - Intergenic
985909969 5:2871671-2871693 GTTTATCTGATGTCACTGGTTGG - Intergenic
987120775 5:14764474-14764496 GTCGCTCTGCTGACCTTGGTGGG - Intronic
991098526 5:62765390-62765412 GTTTCTCTGCTGTATGTGATAGG + Intergenic
991195013 5:63922283-63922305 GGGTTTCTGGTGACAGTGGTGGG - Intergenic
992265093 5:75010375-75010397 GTTACTCTTCTCACTGTGGTTGG - Intergenic
992926310 5:81591421-81591443 GTTTGTCTGTTGACAGTGTGTGG - Intronic
998770192 5:145534723-145534745 TTTTCTGTGCTCACAGTGTTGGG + Intronic
999118360 5:149185261-149185283 GTGGGTCTGCTGGCAGTGGTTGG + Intronic
999873626 5:155777680-155777702 CTTTCACTGCTAACAGTGGTGGG - Intergenic
999891329 5:155981360-155981382 GTTAAACTGCTGACAGTGCTTGG + Intronic
1000090360 5:157924828-157924850 GTTTCTCTTCTCAAAGTCGTGGG - Intergenic
1000334336 5:160230895-160230917 GTCTCTCTGCCCACAGTGTTTGG - Intronic
1002156209 5:177282257-177282279 TTTCTGCTGCTGACAGTGGTAGG + Intronic
1002694195 5:181073202-181073224 GTTTCTCTGTTGACCGTCATGGG + Intergenic
1004317457 6:14602467-14602489 GTTTCACTGCTAACAGTGGTTGG - Intergenic
1005762795 6:28983051-28983073 GTTTCTCTCCTGACAAGGTTTGG + Intergenic
1006931951 6:37693989-37694011 GTGTCTCTGCTGAGGCTGGTAGG - Intronic
1008562429 6:52735851-52735873 GTTTCTCTGGGGGCAGTGTTGGG + Intergenic
1010298828 6:74234058-74234080 GATATTTTGCTGACAGTGGTGGG + Intergenic
1014690202 6:124554294-124554316 GTTTTTCTGCTGCCAGTGTGGGG + Intronic
1014968632 6:127787501-127787523 ATTTCCCTGGTGCCAGTGGTAGG - Intronic
1016100816 6:140097807-140097829 GTTTCTCTGCTGATCTTGCTTGG - Intergenic
1019934214 7:4243802-4243824 GATTCTCTGCTGAGAGGGGAAGG + Intronic
1021342130 7:19478529-19478551 GTTCCCCTCCTGACACTGGTAGG - Intergenic
1023112748 7:36830623-36830645 GTTTATCAGCTGACAGGGGCTGG + Intergenic
1023294326 7:38699264-38699286 GTTTCCCTGCTGAGTGTGATGGG + Intergenic
1023738342 7:43254627-43254649 AACTCTCTGCTGACAATGGTGGG - Intronic
1027180553 7:75936404-75936426 GTTTCTCTTGTGACAGGTGTTGG + Intronic
1029046619 7:97635916-97635938 GTTTCTCCTCTTACATTGGTGGG + Intergenic
1029789463 7:102827336-102827358 GTGGTTCTTCTGACAGTGGTTGG - Intronic
1031475856 7:122220647-122220669 GTAGCTGTGTTGACAGTGGTTGG - Intergenic
1032658716 7:133959689-133959711 TTTTTTCTTCTGACAGTTGTAGG - Intronic
1032774032 7:135091132-135091154 GATTCCCAGCTGACCGTGGTTGG + Intronic
1033653771 7:143360666-143360688 GTTTCTCTGCTCACTGTTTTTGG - Intronic
1035452838 7:158989535-158989557 GTTTCTGTGCTCACACTGCTCGG - Intergenic
1041310183 8:56509000-56509022 GTTTCTCAGTTACCAGTGGTAGG + Intergenic
1045035872 8:98176214-98176236 TTTCCTCTGCTGCCTGTGGTGGG + Intergenic
1046850855 8:118971307-118971329 GTTTCTATGCTGAAAGTCATAGG + Intergenic
1051168949 9:14298566-14298588 TTTTGTTTGCTGACAGTGATGGG - Intronic
1053400808 9:37819761-37819783 GTATTTCTGCAGAGAGTGGTAGG - Intronic
1056043079 9:82687762-82687784 CTTTCTCTGCTGATAAAGGTGGG + Intergenic
1057474098 9:95384288-95384310 GGTTCTCTGCTGTCACTGCTGGG - Intergenic
1057791274 9:98126755-98126777 GTCTCTCTGCAGGCAGTGGGTGG + Exonic
1058216021 9:102234426-102234448 GTTTTTCTCATGACAATGGTGGG + Intergenic
1059443340 9:114323311-114323333 CTTTCCCTGCTGGCTGTGGTCGG + Intronic
1059467918 9:114481114-114481136 GTTTGTCTGTTGAGAGTGTTGGG - Intronic
1059895417 9:118858929-118858951 ATTTCTCTGGGGTCAGTGGTGGG - Intergenic
1062656986 9:137608838-137608860 GTTTCACTTTGGACAGTGGTTGG + Intronic
1185636976 X:1559922-1559944 GCCTCTCTGCTGACAGCCGTGGG - Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1189094814 X:38126826-38126848 ATTTCTCACCTGACAGTGTTGGG + Exonic
1189099038 X:38170340-38170362 GTTTTTGTGTTGACAGGGGTAGG - Intronic
1189699409 X:43701630-43701652 CTTTCTGTGCTGCCAGTGGGAGG - Intronic
1189905298 X:45753196-45753218 GTATTTGTGCTGACAGTGGAAGG + Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1194953092 X:100150370-100150392 GTTGTTCTTCTGTCAGTGGTGGG + Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic