ID: 949764692

View in Genome Browser
Species Human (GRCh38)
Location 3:7513222-7513244
Sequence CTGTGAAAACACCAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949764692_949764699 27 Left 949764692 3:7513222-7513244 CCTTTCTCCTGGTGTTTTCACAG 0: 1
1: 0
2: 1
3: 32
4: 299
Right 949764699 3:7513272-7513294 ACTGCATGGATTAAAATCATTGG 0: 1
1: 0
2: 0
3: 23
4: 236
949764692_949764698 13 Left 949764692 3:7513222-7513244 CCTTTCTCCTGGTGTTTTCACAG 0: 1
1: 0
2: 1
3: 32
4: 299
Right 949764698 3:7513258-7513280 TCAAAATAGTTGTTACTGCATGG 0: 1
1: 0
2: 1
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949764692 Original CRISPR CTGTGAAAACACCAGGAGAA AGG (reversed) Intronic
901292735 1:8136921-8136943 CTGTCAAAACACAAGTGGAACGG - Intergenic
904250582 1:29221261-29221283 CCGTGGAAACACTGGGAGAAGGG + Intronic
905416944 1:37810145-37810167 CTGAGAACACAGCAGGAAAAGGG + Exonic
907398312 1:54207987-54208009 CTGGAAAAACACCTTGAGAATGG - Intronic
907404436 1:54245238-54245260 GTGTGAAAACTCCAGGAGGCTGG + Intronic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
908306149 1:62819281-62819303 CTGGGAAAAAAGCAGGAGATTGG + Exonic
908309300 1:62860479-62860501 CTGTGACAACACTAGGTGATAGG + Intronic
908690227 1:66771267-66771289 CTGTGAAAATACCAGTAGATTGG - Intronic
908886170 1:68791417-68791439 CTGTGAAGACACAAGAAGATGGG + Intergenic
909645012 1:77907228-77907250 CTGTGTTAACACAAGGATAAAGG - Intronic
909990311 1:82215571-82215593 ATGAGAAAAAACCTGGAGAATGG - Intergenic
910149062 1:84119450-84119472 CTTTGAAAGCATCAGTAGAAGGG - Intronic
911627769 1:100145542-100145564 CTGTGAAATAAACAGAAGAATGG - Intronic
911732502 1:101305662-101305684 CGGTGAGAACCACAGGAGAAAGG - Intergenic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
915847068 1:159277590-159277612 CTGGGAAAACACCTAGATAAAGG + Intergenic
916553723 1:165874818-165874840 CTAAGAAAACACCAGGGCAAAGG - Intronic
916825620 1:168439243-168439265 CTTTAAAAAGACCAGGAGAGTGG + Intergenic
918127239 1:181595493-181595515 TGCTGAAAACACTAGGAGAAAGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919079604 1:192854353-192854375 GTAAGAAAACAGCAGGAGAAGGG - Intergenic
919132571 1:193469738-193469760 CTGGGAAAACCCCAAAAGAATGG - Intergenic
919417395 1:197328605-197328627 GTGTGAACACCCCAGGAGAAAGG + Exonic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
920086412 1:203421059-203421081 CTTTGCAAACATGAGGAGAAAGG + Intergenic
921252441 1:213310485-213310507 CTGTGAAAGAACCAGAAGGAAGG - Intergenic
924172701 1:241357800-241357822 CTGTGAAAACCGCAGGCAAACGG - Intergenic
1063138409 10:3236625-3236647 CTGGGATAATACCAGGACAAAGG - Intergenic
1063318875 10:5033705-5033727 CTATGAAAACACTATGAGCAAGG + Intronic
1063811325 10:9712248-9712270 TTTTGAAAACAGCAAGAGAAAGG - Intergenic
1063819138 10:9814109-9814131 CAGTAAAACCACAAGGAGAAAGG - Intergenic
1066349957 10:34628039-34628061 CTGTGCAAATCCCAGGAGAGTGG - Intronic
1068728855 10:60333834-60333856 CTTTAAAAACACTATGAGAATGG - Intronic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1072954424 10:99876256-99876278 CTGTGTAAAGACCATCAGAAAGG + Exonic
1073857112 10:107689597-107689619 CTGGGAGAACTCCAGGAGAGTGG - Intergenic
1074230925 10:111534167-111534189 CTGTGTGAAAACAAGGAGAAAGG + Intergenic
1074267228 10:111916548-111916570 CTGTGATGATTCCAGGAGAAAGG + Intergenic
1074459836 10:113626680-113626702 TTGTGATAACACCATGACAATGG - Intronic
1075793834 10:125104929-125104951 CTGTGAAAACACCAGGCCCGAGG + Intronic
1078868488 11:15321598-15321620 TTGTGAAAACAATAGGGGAAGGG + Intergenic
1079843331 11:25430946-25430968 CAGTGAGAACACATGGAGAAAGG + Intergenic
1081353556 11:42085801-42085823 GTGGGGAAACACCAGAAGAATGG - Intergenic
1082295921 11:50441181-50441203 CTGCCACAACACCAGGAAAATGG + Intergenic
1082589720 11:54990942-54990964 CAGTGAGAACACTTGGAGAAAGG + Intergenic
1083425254 11:62581058-62581080 CTGGGAAAAGTCCATGAGAATGG - Intronic
1086128743 11:83378663-83378685 GTGTGAAGACACAGGGAGAAAGG - Intergenic
1087580585 11:100046881-100046903 CTGGAAAAACACTAGGATAATGG - Intronic
1089891401 11:121885059-121885081 CTGTGATCACAACAGAAGAAAGG + Intergenic
1090216965 11:124976689-124976711 CTGGAAAAACACCAGTTGAAAGG - Intronic
1091808898 12:3378661-3378683 CTGTGAAAAGAACAGAAGAAGGG - Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1093165077 12:15795169-15795191 ATTTCAAAACACCAGGGGAAAGG + Intronic
1095380710 12:41587857-41587879 CTTTGAAATCACCAGCATAATGG + Intergenic
1097762455 12:63483255-63483277 ATGTTACAGCACCAGGAGAAAGG - Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1103058790 12:117842434-117842456 CAGTGAAAACATCAGCAGATAGG + Intronic
1103700943 12:122848474-122848496 CTGGGCACACACCACGAGAAGGG + Exonic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1106070558 13:26407157-26407179 CTGTGTGAAGACTAGGAGAAGGG - Intergenic
1106396293 13:29384134-29384156 CTGTGAATATATCTGGAGAAAGG + Intronic
1106407436 13:29486127-29486149 CTATGAACCCACCAGGAGAAAGG - Intronic
1106594555 13:31125313-31125335 CTGGGATCTCACCAGGAGAAGGG - Intergenic
1106878623 13:34104698-34104720 AAGTAAAACCACCAGGAGAAGGG + Intergenic
1106949445 13:34866793-34866815 TTGTGAAAACAACAGAAGCAAGG + Intergenic
1107016834 13:35714427-35714449 CTGGGAGAAAAACAGGAGAAAGG + Intergenic
1107278532 13:38705843-38705865 CTGTGAGAAAGACAGGAGAAAGG - Intronic
1107708222 13:43127719-43127741 GTGTGAAAACAGCAAGATAAAGG - Intergenic
1109489424 13:63076645-63076667 CAGTGAAATCCCCAGGGGAAAGG - Intergenic
1111673663 13:91360073-91360095 CTTTGAAATCACCAGGAAAAAGG + Intergenic
1112418457 13:99225971-99225993 CTATGAAAAAAGCAGGACAAAGG + Intronic
1112610216 13:100948100-100948122 CTGTGGAAGCCCCAGGAGCAAGG - Intergenic
1113382052 13:109813219-109813241 CTGTGAAAACATCGCCAGAAGGG + Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1119415125 14:74464812-74464834 CAGTGAAAACATCTTGAGAAAGG + Intergenic
1120501596 14:85303899-85303921 CTGTGAGAAGCCCAAGAGAAAGG - Intergenic
1121767106 14:96497356-96497378 GTGTGGAAACACCAGACGAAGGG - Intergenic
1121951886 14:98178012-98178034 CTGTGCGAAGATCAGGAGAATGG + Intergenic
1122262588 14:100531729-100531751 CTGTCAGAACAGGAGGAGAAAGG - Intergenic
1126702719 15:51382327-51382349 CTGTGAACACAACAGGATACAGG + Intronic
1126859837 15:52872921-52872943 CTGAGAAACTTCCAGGAGAAGGG - Intergenic
1128229466 15:66024729-66024751 TTGTGAAAACCAAAGGAGAAGGG + Intronic
1128385565 15:67145812-67145834 CGGTGGAAACAACAGGAGACTGG - Intronic
1129186386 15:73909698-73909720 GTCTGAAAACACCAGAAGAGGGG - Intergenic
1129666769 15:77583557-77583579 ATGTGAGGACACCATGAGAAGGG + Intergenic
1129745747 15:78019556-78019578 CTTTTAAGACACCAGTAGAAAGG - Intronic
1131562419 15:93456056-93456078 CTTTGTAACCAACAGGAGAAGGG - Intergenic
1132741902 16:1418292-1418314 CTTTGAAAACTCCAGGAGTAGGG + Intergenic
1133320822 16:4912781-4912803 CTCTGAGAAGATCAGGAGAAAGG - Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1135513726 16:23111757-23111779 TTGTGAGAAAATCAGGAGAATGG + Intronic
1136172417 16:28496910-28496932 CTGGGAAAACCGCACGAGAAAGG + Exonic
1137291963 16:47057872-47057894 CTGAGTAAACGCCAGGAGACAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138794531 16:59952151-59952173 CTGTGTAAACTCCCTGAGAACGG - Intergenic
1139194431 16:64902559-64902581 TGGTGAAGACACTAGGAGAAGGG + Intergenic
1139653807 16:68375655-68375677 CTGGGATCACAGCAGGAGAAAGG - Intronic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1140456046 16:75106177-75106199 CTGTGCAGAGCCCAGGAGAATGG - Intronic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1141710318 16:85695213-85695235 CAGTGAAGACACGAGGAGATGGG + Intronic
1141823019 16:86460623-86460645 CTGGGAACACACCAGAAGCAAGG + Intergenic
1142760620 17:2039995-2040017 CCGTGTAAACCCCAGGAGACGGG - Intronic
1146740074 17:35275851-35275873 ATGTGAAAAGACGGGGAGAATGG + Intergenic
1147202393 17:38811669-38811691 CTGTCAACACACCAGGGGAAGGG + Intronic
1148778472 17:50108962-50108984 GTTGGACAACACCAGGAGAAAGG - Intronic
1150168640 17:62967646-62967668 CTGTGTAAAAATCAGGAAAAGGG - Intergenic
1151283539 17:73093592-73093614 CTGTGAAAAGACCAGAGGATAGG + Intergenic
1152553042 17:81039328-81039350 CTGAGCAAGCACCAGCAGAAGGG - Intronic
1152583273 17:81178410-81178432 CTCTGAATACACCAGGGGCACGG - Intergenic
1153875227 18:9364437-9364459 GGGTGAAATCACCAGGTGAAAGG - Intronic
1157056609 18:44236535-44236557 CTGTGAAAACTTCAGGATAAAGG + Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1160234951 18:77078442-77078464 CTGTGACAACTTCTGGAGAAGGG + Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162858191 19:13485667-13485689 ATGAGAAATCACCATGAGAAAGG + Intronic
1163389302 19:17020666-17020688 ATGGGAAAACACCAGGGGAGAGG + Intronic
1164120417 19:22260813-22260835 CTGTGAAGTCACCAGCTGAAGGG + Intergenic
1164336083 19:24322775-24322797 CTGCCAAAACACCAGGGAAATGG + Intergenic
1165345507 19:35246502-35246524 AAGTGAAAAAACCTGGAGAATGG + Intergenic
1165354692 19:35296220-35296242 TTTTGGAAACACCTGGAGAAAGG + Intronic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1167747672 19:51362000-51362022 CTTTCAAGACCCCAGGAGAAAGG - Intronic
926489044 2:13500964-13500986 CTGTGAAAACACCAATTAAAAGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
927319139 2:21722242-21722264 CTGTGTCAACACCAGAACAAAGG - Intergenic
927665226 2:25027313-25027335 GTTAGAAAACACCAGGAAAAGGG + Intergenic
929487041 2:42363943-42363965 CTGTGAAAGCGCCTGGGGAATGG + Intronic
930151463 2:48064357-48064379 AACTGAAAACACCAGGAAAATGG + Intergenic
930419484 2:51133424-51133446 CTGGAAAGAGACCAGGAGAATGG + Intergenic
932004139 2:67911248-67911270 CAGTCAAAACACCAGGGGAGTGG - Intergenic
932061669 2:68506757-68506779 TTGTGAAAACACCTGCAGAAAGG + Intronic
932575290 2:72959339-72959361 CTGACAAAACCCCAGAAGAAAGG + Intronic
933393872 2:81707146-81707168 AAGTGAAATCACCAGGAGCAGGG - Intergenic
933672695 2:85024174-85024196 CTGTGAAAAGACGAAGAAAAAGG + Intronic
934085273 2:88504144-88504166 CCGTGAACCCACCGGGAGAAAGG + Intergenic
939005592 2:136783191-136783213 CTGAGAAAACAAGATGAGAATGG - Intronic
942318333 2:174714511-174714533 GTTAGAAAACACCAGGAGAGGGG - Intergenic
942349360 2:175036938-175036960 CTTTAAAAAGACCAGGGGAATGG + Intergenic
942954549 2:181759054-181759076 CTGTGACAACACCTAGTGAAGGG + Intergenic
943676561 2:190721514-190721536 CTGAGAAAAAAGCAGGTGAAAGG - Intergenic
946068406 2:217010060-217010082 CTATGAAAACAGCAGGAGATGGG + Intergenic
946379373 2:219334689-219334711 ATTTTAAACCACCAGGAGAATGG + Intergenic
948181966 2:235989400-235989422 AGGTGAAAACATCAGGAGGAGGG + Intronic
1168753499 20:299757-299779 CTGAGAAATCACCTGGAGGAGGG + Exonic
1168817926 20:753560-753582 CTATGAAAGAAACAGGAGAATGG + Intergenic
1169677335 20:8168808-8168830 CTGTAAAAACACTGGGAAAATGG + Intronic
1170198952 20:13721526-13721548 ATGTGAGAACACCTGAAGAAGGG + Intronic
1170512623 20:17094455-17094477 TTATGAAAGCACCTGGAGAAAGG + Intergenic
1172307057 20:33888322-33888344 CTGGGAAACCACCAGGAGCTAGG - Intergenic
1172781585 20:37439765-37439787 CTCTGAAAAACCCAGGAGAGGGG - Intergenic
1173569447 20:44067100-44067122 TTGTGAAAAAAACAGGAGCAAGG - Intronic
1173664291 20:44753913-44753935 CTGTGCAGACACCAGGGGAAGGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174978312 20:55360972-55360994 CTGTGAAAACAACATGAGAAAGG + Intergenic
1177723150 21:24933528-24933550 CTTTGATATCACCAGGAGATAGG - Intergenic
1180570936 22:16718133-16718155 CTGCGCCACCACCAGGAGAAGGG - Intergenic
1180987901 22:19916240-19916262 GTGTGGTAACACCAAGAGAACGG + Intronic
1181308786 22:21932489-21932511 GTGAGAAGACACCAGGGGAAAGG - Intronic
1181972142 22:26698974-26698996 CTGTGAACAGACCAAGAAAAGGG - Intergenic
1184964262 22:47956628-47956650 ATGTAAAAACACCAGCAGCAGGG - Intergenic
1185060446 22:48603693-48603715 ATGTAAAACCTCCAGGAGAAGGG - Intronic
949478667 3:4472593-4472615 CTGTGAAACCCCAAGGAGAGAGG + Intergenic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
950653921 3:14424942-14424964 CTGGGAAAATACCAGCTGAACGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
951581350 3:24167504-24167526 TTCTGAAAACCCCAGGAAAAAGG + Intronic
952999956 3:38923413-38923435 CTGTGAGACCACCAAGGGAAAGG - Intronic
953760782 3:45685259-45685281 CTTTAAAAACCCCAGAAGAATGG + Exonic
954006036 3:47591316-47591338 CTGTGAAATCACCATTAAAAGGG + Intronic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955420466 3:58731499-58731521 CTATAAAAACACCAGGGGAATGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
956349992 3:68323916-68323938 CTGAGGAAATACCAGAAGAAGGG + Intronic
956401528 3:68884652-68884674 CAGTGAAAAAGCCAGCAGAATGG + Intronic
957621333 3:82596445-82596467 CTGTTCAAATAACAGGAGAAGGG + Intergenic
959536223 3:107488439-107488461 CTGGGAAAACACCAGCAGTCTGG - Intergenic
960010705 3:112831946-112831968 CAGTGAAAATATCAGTAGAAAGG + Intronic
961709758 3:128819102-128819124 ATGTGGAGACACCAGGAGAGAGG - Intergenic
962118617 3:132538368-132538390 CTGTCATGAAACCAGGAGAAAGG - Exonic
962907917 3:139822360-139822382 CAGTGAGAACACCTGGACAAAGG + Intergenic
964445885 3:156756795-156756817 TTGAGAAAAAAACAGGAGAAAGG - Intergenic
966753840 3:183349796-183349818 CTGTGAAAAAAACAGTGGAAGGG - Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
968835166 4:2958481-2958503 CTGTGTAAACACCAGTGTAATGG - Intronic
969109833 4:4837418-4837440 CTCTGAAAATATCAGCAGAAAGG + Intergenic
969899415 4:10335099-10335121 CAGCGAGAACACTAGGAGAAAGG - Intergenic
969925931 4:10585914-10585936 CTGTGGAAATACCAGGAAACTGG - Intronic
970176078 4:13340768-13340790 CTCTAAAGGCACCAGGAGAAGGG - Intergenic
970422087 4:15914843-15914865 GTGGGCAAGCACCAGGAGAAGGG + Intergenic
971107820 4:23546063-23546085 TTTTGAAAACACCAGGTGAGAGG - Intergenic
973688756 4:53403101-53403123 CTGTGAATAAACTAGGTGAAAGG + Intronic
974319082 4:60321478-60321500 CTCAGAAAACACAAGGATAAAGG + Intergenic
974604874 4:64139139-64139161 CTGTGAACATACCAAGAAAAAGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975233926 4:71969056-71969078 CCATGATAACACCAGGGGAATGG + Intergenic
975261838 4:72312042-72312064 CGGTGAAAAGACCAGTGGAAAGG - Intronic
976837885 4:89396477-89396499 CTGGGAAATCACCACAAGAAAGG - Intergenic
980267677 4:130540387-130540409 ATGTGAAAAAAACAAGAGAAAGG - Intergenic
980599124 4:134996948-134996970 TTTTGAAAACACCTGAAGAAGGG + Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981818617 4:148860437-148860459 AAATGGAAACACCAGGAGAAGGG + Intergenic
982919009 4:161250423-161250445 CTTTGAAAGCATCATGAGAAAGG + Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984567714 4:181350631-181350653 TTGTGAACACACAAGGATAAGGG + Intergenic
984866406 4:184284128-184284150 CTCTCAAAACAGCAGGAGATGGG + Intergenic
985427065 4:189841348-189841370 CTGCATAAACACCAGGGGAAAGG - Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
986047839 5:4057791-4057813 CTTGGAAAACACCAGCAGGATGG - Intergenic
987147232 5:15004138-15004160 CTGAGAAAGCACCTGCAGAAAGG + Intergenic
987924874 5:24327785-24327807 CTGAGGAAACACCATGTGAAAGG - Intergenic
988073821 5:26326377-26326399 CTGTGAAAACACCTGGATTCAGG + Intergenic
989747387 5:44846313-44846335 TTGTGAAAACAAAAGGAGAGGGG - Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990780658 5:59358432-59358454 CTTTGAGAACACCAGGAAAGTGG - Intronic
991054001 5:62302951-62302973 AAGTGAAAATACCAGGTGAAAGG - Intergenic
992170512 5:74097164-74097186 CTGTGAAGAACCCAGGAGAATGG + Intergenic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
993347307 5:86800268-86800290 TTGTGAAAACAGAAGCAGAAAGG + Intergenic
994249729 5:97521817-97521839 CTGTGGAAACACAAGGTGATAGG + Intergenic
995085152 5:108099919-108099941 CTGTGAAAAGATCAAGAAAATGG - Intronic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000176297 5:158758425-158758447 CTATGAAACAACCAGCAGAATGG + Intronic
1000528478 5:162388231-162388253 ATGTGAAGACACCATGAGACAGG - Intergenic
1000815073 5:165910946-165910968 TTTTGAAAACTCTAGGAGAAGGG + Intergenic
1001116300 5:168943208-168943230 TAGTGAATACACCAGAAGAAGGG + Intronic
1001247173 5:170113451-170113473 CTGTGAAAACACAATGAAATTGG + Intergenic
1002213784 5:177613655-177613677 CTGTGAAGACACCAGGGATACGG + Intergenic
1002364120 5:178696894-178696916 CTGGGAAAACACCGCGAGAAAGG + Intergenic
1002878439 6:1231633-1231655 CAGTGAAAAGACCAGGGCAATGG + Intergenic
1004404231 6:15317189-15317211 CTGTGAAATCCCCTTGAGAAAGG + Intronic
1004863452 6:19831017-19831039 TTTTGAAAGCCCCAGGAGAAAGG - Intergenic
1005350724 6:24932712-24932734 CTGTGTAACCTCTAGGAGAAAGG + Intronic
1005890565 6:30134643-30134665 CTTTGAAATCACCAGGATCATGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007251769 6:40500142-40500164 CTGTGAGAACACCAGGCTGATGG - Intronic
1008035690 6:46742708-46742730 CTGTGAAAGCTCCAGCAAAATGG + Intergenic
1008111429 6:47499601-47499623 CTGGAAAACTACCAGGAGAAAGG - Intronic
1014163737 6:118200378-118200400 AAGTGGAAACACCAGGAGTAAGG + Intronic
1014548000 6:122754930-122754952 CTGGGAAATAACCAGTAGAAAGG - Intergenic
1015573616 6:134647694-134647716 ATGGGATAACACCAGGAGTAGGG - Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016107403 6:140179693-140179715 AAGTGGAATCACCAGGAGAAGGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016389336 6:143559372-143559394 CTGAGGAAATATCAGGAGAAAGG + Intronic
1017370358 6:153698469-153698491 TCGCCAAAACACCAGGAGAAAGG + Intergenic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1020058028 7:5132016-5132038 CGGTGAAAACAGGAAGAGAATGG - Intergenic
1020066369 7:5190924-5190946 CGATGAAAAGACAAGGAGAAGGG - Intronic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020642102 7:10768241-10768263 CTGGGATAAGACCAGGAGAATGG - Intergenic
1021247032 7:18275726-18275748 CTGAGAAAACACCCGAGGAAGGG - Intronic
1021939630 7:25666938-25666960 CTGTGAAACCATTAGGTGAAAGG - Intergenic
1022394425 7:29973255-29973277 CTCTGAAAACACCATGAGAGTGG + Intronic
1023027679 7:36065570-36065592 CCATGAACCCACCAGGAGAAAGG - Intergenic
1024480859 7:49861064-49861086 CTGTGCAGACACCATGATAAAGG - Intronic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1024973536 7:55092435-55092457 CTATGAAATCACCAGGAAATTGG - Intronic
1026331760 7:69358270-69358292 CTAGGAAAACACTAGGAAAAAGG + Intergenic
1027484977 7:78750075-78750097 CAGTGAAAACACATGGAGATGGG - Intronic
1030148733 7:106381754-106381776 CACTGAAAACACAAGGAAAACGG - Intergenic
1031137576 7:117901595-117901617 CTGTGACAGCACAAGGAGCAAGG + Intergenic
1032864134 7:135909150-135909172 CTCTCAAAACACCAGTAGACAGG - Intergenic
1033582072 7:142747392-142747414 CTGTGAAGACCCCATGACAAGGG + Intergenic
1033585082 7:142768765-142768787 CTGTGAAGACCCCATGACAAGGG + Intergenic
1035529321 8:338345-338367 CTGTGAAAACATGAGGAGTAGGG + Intergenic
1035979096 8:4348898-4348920 CTGTGATATCACAGGGAGAAAGG - Intronic
1037674539 8:21042467-21042489 TGGTTAAAATACCAGGAGAAAGG + Intergenic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038253852 8:25932067-25932089 TTGAGAAGCCACCAGGAGAAGGG + Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1041198913 8:55430788-55430810 ATGTGAAGACACCAGAAGACAGG - Intronic
1042690352 8:71491583-71491605 ATGTGAAGACACAAGGAGAGGGG + Intronic
1045186054 8:99839314-99839336 CTGTGAAAACACTTGGTAAATGG - Intronic
1045484325 8:102618894-102618916 CTGTGATGACACTAGGAGATAGG - Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047624681 8:126644453-126644475 CTGTGAGGACACAATGAGAAGGG + Intergenic
1047884568 8:129234905-129234927 TTGTAGAAACACCATGAGAAAGG + Intergenic
1049128928 8:140819311-140819333 CTCAGAAAACACCAGGCCAAAGG + Intronic
1050146421 9:2572908-2572930 CTGTTGAAACACCAGGAAATAGG - Intergenic
1052882598 9:33612932-33612954 CTGTGAAGACCCCATGACAAGGG - Intergenic
1052902326 9:33804033-33804055 CTGTGAAGACCCCATGACAAGGG + Intergenic
1052980075 9:34441693-34441715 CTGTAAAAACATTAGGTGAAAGG + Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053438374 9:38093192-38093214 TCGTGAAAACATCAGGGGAAAGG - Intergenic
1054784245 9:69195554-69195576 ATGTGAAAAAAGCAGGAGTAGGG + Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055930373 9:81553988-81554010 CTGTGAAATCCCCAGCAGCAGGG - Intergenic
1056822951 9:89856415-89856437 CTGTGGAAGCACCAGGCGAGGGG + Intergenic
1057129449 9:92642811-92642833 CTGTGAAAACACCAACAGGAGGG + Intronic
1059469069 9:114490307-114490329 ATGTGAATACACAAGGATAAAGG + Intronic
1059943518 9:119381948-119381970 CTAAGAAAACACAGGGAGAAAGG - Intergenic
1060605255 9:124908347-124908369 CTTAGGAAACACCAGGAGTAAGG + Intronic
1061040019 9:128135863-128135885 CTGTGGAAGCACCAGGCGAGGGG - Intergenic
1186616064 X:11189328-11189350 CTCTGAACACCTCAGGAGAAAGG - Intronic
1187892783 X:23952817-23952839 CTGTGAAGACAAAAGGAGAGTGG - Intergenic
1188304301 X:28543434-28543456 CTCTGAAAACAGCAGAGGAATGG + Intergenic
1189206402 X:39243035-39243057 CTCAGGAAACACCAAGAGAAGGG - Intergenic
1189365757 X:40387282-40387304 CAGTGAAATCACCAGGAAATAGG + Intergenic
1190441372 X:50478088-50478110 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1190557921 X:51655564-51655586 CTGTGAAAACACCAAAATAAAGG + Intergenic
1190929260 X:54934346-54934368 TTGTGGCAACACCAGGAGTATGG + Intronic
1191971084 X:66817029-66817051 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1192285153 X:69727464-69727486 GTGAGAACACAGCAGGAGAATGG - Intronic
1193634426 X:83930787-83930809 CTGTGAAAAGCAGAGGAGAAAGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1196921453 X:120590005-120590027 CTTTGAAAAAGCCAAGAGAAAGG + Intergenic
1198194326 X:134344789-134344811 CTGTGAAAAGACAAAGACAAGGG + Intergenic
1199843012 X:151669888-151669910 CTGAGTATACACCAGAAGAAAGG - Intronic
1200685110 Y:6251001-6251023 CTGTGATAATACCAGAAGAAGGG - Intergenic
1200990636 Y:9342271-9342293 CTGTGATAATACCAGAAGAAGGG - Intergenic
1200993298 Y:9362588-9362610 CTGTGATAATACCAGAAGAAGGG - Intronic
1200995958 Y:9382859-9382881 CTGTGATAATACCAGAAGAAGGG - Intergenic
1200998620 Y:9403211-9403233 CTGTGATAATACCAGAAGAAGGG - Intergenic
1201001130 Y:9471741-9471763 CTGTGATAATACCAGAAGAAGGG - Intronic
1201003794 Y:9492069-9492091 CTGTGATAATACCAGAAGAAGGG - Intergenic
1201006448 Y:9512350-9512372 CTGTGATAATACCAGAAGAAGGG - Intergenic
1201009105 Y:9532659-9532681 CTGTGATAATACCAGAAGAAGGG - Intergenic