ID: 949774093

View in Genome Browser
Species Human (GRCh38)
Location 3:7611931-7611953
Sequence ATTCTCATGAAGAATATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949774093 Original CRISPR ATTCTCATGAAGAATATAAT AGG Intronic
901096790 1:6687733-6687755 ATTCACATGTAGAATATCTTTGG + Intronic
902043393 1:13508611-13508633 AGTATCATGAAGAAAATAAAAGG - Intronic
905049886 1:35041274-35041296 ATTTCTATGAAGAATATCATTGG - Intergenic
906369205 1:45237953-45237975 AATATCATTAAGAAAATAATAGG + Intronic
907536966 1:55171345-55171367 AATATCATGAAGAATTTTATAGG - Intronic
907605270 1:55810728-55810750 TTTTTCATGAAGAATGTCATTGG - Intergenic
908055329 1:60279884-60279906 ATTCTTTTGAAGAATCTAAAAGG + Intergenic
908573225 1:65431719-65431741 TTTCTAATGCAGAAAATAATAGG + Intronic
909297023 1:73963603-73963625 ATTCTCATGGAGTAAATAAGTGG - Intergenic
910016653 1:82533591-82533613 CTTCTCATGGAGTATATTATTGG + Intergenic
910558396 1:88562824-88562846 TTGCACATGAAGAATATAAAAGG - Intergenic
910701367 1:90078054-90078076 ATTCTCATCAACAGTATACTAGG + Intergenic
911406005 1:97440323-97440345 AATCTCATGAAAAATGTAAATGG - Intronic
911881571 1:103245712-103245734 ATTATATTAAAGAATATAATGGG - Intergenic
912998950 1:114560505-114560527 TTTCTAAAGAAAAATATAATAGG - Intergenic
913013249 1:114706336-114706358 ATTCTCATGAAAAATAGACTTGG - Exonic
913712993 1:121505241-121505263 ATACTCATCAAGGATATTATTGG - Intergenic
915337590 1:155155210-155155232 ATTTTCGTGAAGAATGTCATTGG - Intergenic
915425603 1:155824120-155824142 ATGCTCATCAAGAATTGAATGGG + Intronic
916316022 1:163448523-163448545 TTTCTCATTAATAATATTATGGG - Intergenic
916591889 1:166199366-166199388 ATCCTCACTAAGAATGTAATGGG + Intergenic
917073467 1:171178336-171178358 ATTCTCATAAAGAATATCTTTGG - Intergenic
917189484 1:172399550-172399572 CTTCTCACGAAGCATTTAATTGG + Intronic
917299414 1:173557448-173557470 ATTCAAATTATGAATATAATTGG - Exonic
917601731 1:176581487-176581509 ATTTTTATGAAGAATGTCATTGG + Intronic
917689600 1:177454681-177454703 ATTTGTATGAAGAATATTATTGG + Intergenic
917820595 1:178759612-178759634 ATTTCCATGAAGAATATTATTGG + Intronic
918848737 1:189654623-189654645 GTACTCATGAAGACAATAATAGG - Intergenic
919498465 1:198307515-198307537 ATTCTCAACAAGAATTTCATAGG + Intronic
919588703 1:199471996-199472018 ATGTTCATAAAGAATAAAATAGG + Intergenic
919592544 1:199522490-199522512 ATTGTCATGAAGAATTTACTAGG - Intergenic
919601466 1:199628008-199628030 ATGTTCATTAAGAATATAAAAGG + Intergenic
920083824 1:203399353-203399375 ATTTCCATGAAGAATGTCATTGG + Intergenic
920590678 1:207215806-207215828 GTTCTCATGAAGAAAATAGCTGG + Intergenic
922495620 1:226055224-226055246 CTTCTTATTAATAATATAATTGG + Intergenic
922549935 1:226487213-226487235 ATTTCCATGAAGAATAGCATTGG + Intergenic
922595780 1:226811615-226811637 ATCCTCATGATAAATATCATGGG + Intergenic
922932103 1:229397890-229397912 ATCCTAATGAAGAATGCAATAGG - Intergenic
924202392 1:241673545-241673567 ATACGCATGTAGTATATAATTGG - Intronic
1063006504 10:1976661-1976683 AGTCTCATGAAGCATAAAAATGG - Intergenic
1063809451 10:9687693-9687715 AATCTCATGAAAAATAAAAATGG + Intergenic
1065248282 10:23782089-23782111 ATTTTCATGAAGAATGCCATTGG + Intronic
1066015428 10:31237843-31237865 ATTTCTATGAAGAATATCATTGG - Intergenic
1066509053 10:36075092-36075114 ATTCTCATTAACAAAATTATGGG + Intergenic
1068159863 10:53249792-53249814 ATTTTGATGAAGAAAATATTAGG + Intergenic
1068206012 10:53854521-53854543 ATTTTCATGAAGAATAAAAGTGG + Intronic
1068344821 10:55761911-55761933 ATTGAGATGAAGAATATAATAGG + Intergenic
1068447748 10:57144936-57144958 ATTATCATGTAGTATATATTAGG + Intergenic
1068674588 10:59757634-59757656 ATTCTCATTAAGAAGCTAACGGG + Intergenic
1069317189 10:67120715-67120737 ATTTTCTTGATGAATATTATAGG + Intronic
1071773653 10:88759682-88759704 ATCCTCATGAAGGATCAAATGGG + Intergenic
1072704901 10:97674069-97674091 TTTCTGATGCAGAATATAATAGG - Exonic
1074716425 10:116223838-116223860 ATTTTCATGAAGAATTTAGGTGG + Intronic
1078984386 11:16577524-16577546 ATTCTCATGAGCAATATATGAGG + Intronic
1079107943 11:17585834-17585856 ATTCTTTTGAAAAATAAAATAGG + Intronic
1079195786 11:18325618-18325640 AGTGCCATGAAGAAAATAATAGG + Intronic
1079644580 11:22846808-22846830 ATTCACATGAACATTATATTTGG - Intergenic
1081305197 11:41503239-41503261 ATTCACATGAAGCAAATAGTAGG - Intergenic
1083040846 11:59685036-59685058 ATTTCCATGAAGAATATCATTGG - Intergenic
1085147796 11:74218370-74218392 ATTTTTTTGAAGAATATCATTGG - Intronic
1085729668 11:78986045-78986067 ATTTTCATTTAGAATATACTAGG + Intronic
1085959303 11:81441242-81441264 AATCTCTTGAAGAATAAAACTGG + Intergenic
1086126103 11:83350192-83350214 TTTCTTATGAAGAATATGAAAGG - Intergenic
1086526508 11:87733587-87733609 AATTTTGTGAAGAATATAATTGG + Intergenic
1086999056 11:93394135-93394157 ATTTTCATGGAGAAAAAAATTGG - Intronic
1087031478 11:93709667-93709689 ATTTCTATGAAGAATATCATTGG + Intronic
1087592130 11:100203419-100203441 ATTCTTCTGAAGAAAATAATTGG + Intronic
1087733882 11:101809984-101810006 ATTCCCAGGAAGAATATGAATGG - Intronic
1087973549 11:104515896-104515918 ATTTTCATGAAGATAAAAATTGG - Intergenic
1088271833 11:108042053-108042075 ATTTGCATGATAAATATAATAGG + Intronic
1088953370 11:114592646-114592668 ATTTCGATGAAGAATATTATTGG - Intronic
1090024336 11:123154832-123154854 ATCCTTTTGATGAATATAATGGG + Intronic
1090110112 11:123898536-123898558 ATGCTGATGAAGAAAAGAATAGG - Intergenic
1091529146 12:1338023-1338045 CTTCTCATGAAGGATCTCATTGG + Intronic
1092326665 12:7538948-7538970 ATTCTGATGAAGAAACTGATGGG - Intergenic
1092394836 12:8116553-8116575 ATTTAAATCAAGAATATAATAGG + Intergenic
1092587788 12:9918628-9918650 AATTTCATGAAGAATATCATTGG + Intronic
1093060950 12:14603179-14603201 ATTTCTATGAAGAATATCATTGG + Intergenic
1093290602 12:17316517-17316539 AATTTCATGAAGAATATCAAAGG + Intergenic
1093842416 12:23920375-23920397 ATTTTCATAAAGATTGTAATAGG - Intronic
1093995822 12:25641403-25641425 ATTGTCAGGAAAAAAATAATGGG + Intronic
1094271187 12:28617848-28617870 TTTCTTATCAAGAATATTATTGG - Intergenic
1094367728 12:29701807-29701829 ATTGACATGATGAATTTAATTGG - Intronic
1094403566 12:30089257-30089279 AATCTCATGGAGAACAAAATAGG - Intergenic
1095175372 12:39085895-39085917 ATTTCCATGAAGAATGTCATTGG + Intergenic
1095678572 12:44948644-44948666 AATTTCAGGAAGAATATAACAGG - Intergenic
1095723725 12:45429199-45429221 ATTCTCATGAAGAAGCTTTTGGG - Exonic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1097905665 12:64916742-64916764 ATTCTAATTAAAAATATAATTGG - Intergenic
1098254236 12:68600175-68600197 AGTGTAATGAAGAATATAATGGG - Intergenic
1098297579 12:69019742-69019764 GTTTTCATGAAGAATGTGATTGG + Intergenic
1098609612 12:72439323-72439345 ATTTTTGTGAAGAATATCATTGG + Intronic
1098894975 12:76048780-76048802 ATTCTCAGGAATAATAGACTAGG + Intronic
1099155178 12:79166482-79166504 ATTCTGAAGAAGAATATTTTAGG + Intronic
1099179962 12:79465079-79465101 AATCTCATGAAAAATATCATAGG - Intergenic
1099285688 12:80711688-80711710 ATTCTCAGGGAGAAAATGATGGG - Intergenic
1099636802 12:85223991-85224013 AATCTCATAAAGTATGTAATTGG + Intronic
1099785966 12:87264419-87264441 ATTCTGATGAATGATAAAATTGG - Intergenic
1100173114 12:91999774-91999796 ATTTTCATGAAGAATGTTATTGG - Intronic
1101128831 12:101667878-101667900 ATTCTCGTGAAGGAAATCATAGG + Exonic
1101140303 12:101789081-101789103 CTTCCCTTGAAAAATATAATAGG - Intronic
1101218554 12:102610936-102610958 ATGCTCATGAAGATTTAAATTGG - Intergenic
1103040457 12:117691012-117691034 ATTCTGATGTAGAAGAGAATCGG + Intronic
1103290225 12:119839538-119839560 ATTCTCAAGAAGAATAATATCGG - Intronic
1103661345 12:122521127-122521149 TTTCATATGAAGAATATGATTGG - Intronic
1106842808 13:33703558-33703580 ATTTCCATGAAGAATGTCATTGG + Intergenic
1108584459 13:51857598-51857620 ATTATCCTGGAGATTATAATAGG - Intergenic
1109400686 13:61823918-61823940 ATTCTCCTTAAAAAAATAATGGG - Intergenic
1110357232 13:74581103-74581125 ATTCACATGAAAAAAATAAATGG + Intergenic
1110486952 13:76057298-76057320 ATTTCTATGAAGAATATCATTGG - Intergenic
1110703080 13:78572160-78572182 ATTCTGATGAAGAAAATAACAGG + Intergenic
1110917353 13:81038762-81038784 ATTCCTTTGAAGAATGTAATTGG - Intergenic
1111315224 13:86547895-86547917 ATTCTTAATAAGAATATTATTGG - Intergenic
1111323272 13:86658617-86658639 ATTCTGAAGAATATTATAATGGG - Intergenic
1112658473 13:101478926-101478948 ATTCTTGTGAAGAATGTCATTGG - Intronic
1113133574 13:107063957-107063979 ATATTCATGCAGAAAATAATTGG + Intergenic
1113147728 13:107227259-107227281 ATTCTAAGGAAGAATCTCATAGG - Intronic
1114963824 14:27930760-27930782 ATTCTCATTAAGGATTGAATAGG + Intergenic
1115279276 14:31642711-31642733 ATTTTTATGAAGAATGTCATTGG + Intronic
1115390587 14:32850585-32850607 ACTTCCATGAAGAATATCATTGG + Intergenic
1115397279 14:32922496-32922518 ATCATCATAAAGAATTTAATGGG - Intergenic
1116375994 14:44201805-44201827 ATTTTGATGTAAAATATAATAGG - Intergenic
1117073048 14:52073415-52073437 ATTCTCATGATTAAAATAACAGG - Intergenic
1117776117 14:59186648-59186670 ATTCTCTTTAACAATATTATAGG - Intergenic
1118116000 14:62777512-62777534 ATACTCATGAAAAAGATAAGTGG - Intronic
1118122673 14:62863009-62863031 GGTTTCATGAAGAAAATAATAGG - Intronic
1119937392 14:78604550-78604572 ATTCTCATGTTGATTATAAATGG + Intronic
1120677314 14:87435699-87435721 TTTCTCATGAAGAATAAGATAGG + Intergenic
1122311593 14:100800073-100800095 ATTCTGAAGAAGAATAAAATTGG + Intergenic
1123670947 15:22656677-22656699 ATCAACATGAAGAATGTAATAGG - Intergenic
1123708899 15:22972011-22972033 ATTTGCATGAAGAATATGGTAGG - Intronic
1123930273 15:25166196-25166218 ATTCTCCTGCATCATATAATGGG - Intergenic
1123973972 15:25535182-25535204 ATTCCCAGGAAGAGTATAGTGGG + Intergenic
1124526884 15:30462974-30462996 ATCAACATGAAGAATGTAATAGG - Intergenic
1124771769 15:32544709-32544731 ATCAACATGAAGAATGTAATAGG + Intergenic
1124796449 15:32785554-32785576 ATTCTCCTAAATAATATGATTGG + Intronic
1124867007 15:33502203-33502225 ATTCTCAAAAATAAGATAATCGG - Intronic
1125406378 15:39356352-39356374 ATACTGATGATGAATACAATTGG - Intergenic
1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG + Intronic
1125902795 15:43364447-43364469 ATTCTCATGATGCAGATGATAGG - Intronic
1125904489 15:43378236-43378258 ATTCTTAGGAAGAAGGTAATAGG + Intronic
1126025083 15:44438585-44438607 CTTGTGATGAAGAATATATTAGG + Intronic
1126564423 15:50080253-50080275 ATTATCTTGGAGAATATAACTGG - Intronic
1126989629 15:54358343-54358365 ATTCCTATGAAGAACATCATTGG + Intronic
1128072029 15:64803629-64803651 ATTCTCATGTAGGATGAAATCGG + Intergenic
1128472875 15:67969949-67969971 ATGCTCATCAAGAACAAAATGGG - Intergenic
1131230961 15:90659044-90659066 CTTCTCAATAAGAAAATAATTGG - Intergenic
1131984354 15:98026513-98026535 AATTTCGTGAAGAATATCATTGG - Intergenic
1132124106 15:99205324-99205346 ATTTCAATGAAGAATGTAATTGG + Intronic
1132136289 15:99343216-99343238 ATTCTCATCAACAAAATGATGGG - Intronic
1132199392 15:99938952-99938974 ATTTCTATGAAGAATATCATTGG + Intergenic
1133731962 16:8585698-8585720 TTTTTCATGGAGGATATAATGGG + Intronic
1137022111 16:35439083-35439105 ACTCTAATGAAGAAACTAATTGG - Intergenic
1138845092 16:60555208-60555230 ATTCCCATGAAGGGTATAATTGG + Intergenic
1138988940 16:62366720-62366742 ATTCCCGTGAAGAATCTCATTGG + Intergenic
1140314115 16:73877307-73877329 AATTGCATGAAGAATCTAATGGG - Intergenic
1140846683 16:78895562-78895584 ATTCTCCTTTAGAATTTAATAGG + Intronic
1140960718 16:79909888-79909910 ATTAACATTAAGAATATATTTGG - Intergenic
1143811472 17:9475244-9475266 ATTCTCTTCAAGAATAGAGTTGG + Intronic
1145407820 17:22622681-22622703 ATTGAGATGAAGAATATAATAGG + Intergenic
1149769431 17:59308721-59308743 ATTATCATTAAGAAAATTATGGG + Intergenic
1150233243 17:63570846-63570868 ATTGTCATGCAGAATATGATTGG + Intronic
1155061089 18:22229211-22229233 ATACTCATGAAGACTAAAAAAGG - Intergenic
1155700302 18:28734961-28734983 ATACTCATCATGAATCTAATTGG - Intergenic
1155785323 18:29891080-29891102 ATTTATATGAATAATATAATAGG + Intergenic
1156120681 18:33839294-33839316 ACTCTGTTGAAGAATATAATTGG - Intergenic
1157094786 18:44678552-44678574 ACTCTCATGAAGAACGTGATAGG + Intergenic
1157633604 18:49126811-49126833 ATTATCATAAAAAATATAAATGG + Intronic
1157994326 18:52536897-52536919 GTTCTCAGAAAGAATATAATTGG - Intronic
1158103699 18:53860881-53860903 ATTCTCATAAAAATTAAAATTGG - Intergenic
1159281057 18:66286574-66286596 ATTCTCAAGAAGAACACAAAGGG + Intergenic
1159306866 18:66654364-66654386 ATTCTCAGCAAGAACATGATAGG - Intergenic
1159612690 18:70544312-70544334 AATATCATGATGAATAGAATAGG - Intergenic
1159774940 18:72593014-72593036 ATTTTCACGAAGAATGTCATTGG + Intronic
1159834267 18:73318392-73318414 ATTCTGAAGAAGAATAAAATTGG - Intergenic
1160305431 18:77729897-77729919 ATTGTCATCAATAAAATAATAGG + Intergenic
1163219489 19:15904959-15904981 ATTTTTATGAAGAATCTCATTGG + Intergenic
1164045110 19:21531193-21531215 ATTCTGTTGAAAAATAAAATGGG + Intronic
1164372790 19:27656483-27656505 ATTCTAATGAAGGAAATACTTGG - Intergenic
1164996528 19:32723588-32723610 ATTCTGAAAAAGAATATAGTTGG - Intronic
1166257500 19:41617057-41617079 TTTCTCATATAGAATAGAATGGG + Intronic
1166293219 19:41876775-41876797 ATACTCATGAAGAATAAATAAGG - Intergenic
1166409691 19:42548211-42548233 TTTCTCATGTGGAATAGAATGGG + Intronic
1167162933 19:47779373-47779395 AGTCTCAGGAAGGGTATAATAGG + Intronic
925788766 2:7460013-7460035 AATCATATCAAGAATATAATAGG - Intergenic
926082734 2:10001299-10001321 TTTCTCATGAAGAATTTTAATGG + Exonic
926550046 2:14290327-14290349 ATTCTCATTAACTATGTAATTGG + Intergenic
929506160 2:42529885-42529907 CTTCTCATTAAGATTACAATCGG + Intronic
930842929 2:55867860-55867882 ATTTTGATGAATAATATGATGGG + Intronic
931147603 2:59536160-59536182 ATTCTCCTGTTGAATATAGTGGG + Intergenic
932101484 2:68904464-68904486 ATTTTCATGACGAATGTCATTGG - Intergenic
932127980 2:69161838-69161860 CTTCTCATGCAGAATTTAAAAGG + Intronic
933114034 2:78444004-78444026 ATTTCCATGAAGAATATCATTGG + Intergenic
933555845 2:83829647-83829669 TGTCTCAAGAAAAATATAATAGG - Intergenic
935437553 2:103052349-103052371 AGACTCATGAAGAATAAAAGGGG - Intergenic
935466734 2:103406885-103406907 ATGTTCAAGTAGAATATAATTGG - Intergenic
935838748 2:107085064-107085086 TTTCCCATGAAGAAAATAATAGG + Intergenic
936554651 2:113484521-113484543 ATCCTCATGAAGCATTTGATGGG - Intronic
936777110 2:115986874-115986896 ATTCTCATTAAGACTGTATTTGG - Intergenic
936777431 2:115990974-115990996 ATTTCCATGAAGAATGTCATTGG + Intergenic
937443346 2:121935371-121935393 ATTTCCATTAAAAATATAATGGG - Intergenic
937563757 2:123258222-123258244 ATTATCATGTACAAAATAATAGG + Intergenic
938002824 2:127758613-127758635 ATTCTCTTTATGAGTATAATGGG + Intronic
938601553 2:132846908-132846930 ATTCTCTGGAATAATAAAATGGG - Intronic
939724629 2:145701399-145701421 ATTTCCATGAAGAATATCATTGG + Intergenic
939763306 2:146211979-146212001 AGTTTCATGAACAATAAAATGGG - Intergenic
940031611 2:149269012-149269034 ATTTTTGTGAAGAATATCATTGG - Intergenic
940432882 2:153614414-153614436 ATTATCATGAAGAATATAGTAGG + Intergenic
940631531 2:156245645-156245667 ATTATCATGTACAAAATAATAGG + Intergenic
941094145 2:161216530-161216552 TTTGACATGAAGAATATACTAGG + Intronic
941123190 2:161555041-161555063 ATTCACAAAAAGAAAATAATAGG - Intronic
941304937 2:163852332-163852354 ATTCTGAAGAAGAATAAAATGGG + Intergenic
942971814 2:181965828-181965850 ATTTCCATGAAGAATGTCATTGG + Intronic
943076642 2:183203674-183203696 ATCCTCCTTAAAAATATAATTGG - Intergenic
943299569 2:186180886-186180908 ATTCTTATGAAGAATAGATATGG - Intergenic
943331597 2:186566514-186566536 ATTTTTATGAAGACTATCATTGG - Intergenic
943825675 2:192388267-192388289 TTTTTCATGAAGAACATATTCGG + Intergenic
943913590 2:193599531-193599553 ATTTCTATGAAGAATGTAATTGG - Intergenic
943933376 2:193883427-193883449 ATTCTCAGGAAGATTTTTATAGG + Intergenic
944029036 2:195210543-195210565 ATTCTCATGAAAACTCTATTAGG + Intergenic
945498974 2:210544761-210544783 ATTCTGAAGTATAATATAATAGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946591702 2:221256564-221256586 ATTTCCATGAAGAATGTCATTGG + Intergenic
947683652 2:232060680-232060702 ATTTATATGAAGAATATCATTGG + Intronic
1173419298 20:42886819-42886841 TTTCTCCTCCAGAATATAATGGG - Intronic
1175511161 20:59527267-59527289 ATTCTCATCAGCAATGTAATGGG - Intergenic
1175586845 20:60147934-60147956 GTCTTGATGAAGAATATAATGGG - Intergenic
1177257028 21:18677813-18677835 ATTCTCATGGAAGAGATAATAGG + Intergenic
1177319618 21:19503891-19503913 ATTTCTGTGAAGAATATAATTGG + Intergenic
1177360749 21:20065993-20066015 ATACTTATGTAGAATAGAATAGG + Intergenic
1177616006 21:23520909-23520931 ATTTCTATGAAAAATATAATTGG + Intergenic
1177735526 21:25084228-25084250 AATTTCATGAAAAAGATAATGGG - Intergenic
1179205486 21:39273072-39273094 TTTCTCATGAAGAAAATTATAGG + Intronic
1181375740 22:22456609-22456631 TTTCTCAAGAACTATATAATTGG + Intergenic
1185192522 22:49447613-49447635 ATTCTCATGAAGAAAGTAAATGG - Intronic
949774093 3:7611931-7611953 ATTCTCATGAAGAATATAATAGG + Intronic
950687580 3:14629444-14629466 ATGCTCATAAAGAATATACTGGG + Intergenic
951285471 3:20807442-20807464 GTTCTCATGAAGCATTTAATAGG + Intergenic
951348741 3:21578856-21578878 ATTTCCATGAAAAATATCATTGG + Intronic
951763651 3:26172620-26172642 ATTGTCATGAAGGACATTATGGG - Intergenic
951904701 3:27693412-27693434 ATTTCTATGAAGAATATCATTGG - Intergenic
952038938 3:29238316-29238338 ATTCTCTTGAAGTATATGAAGGG + Intergenic
952555870 3:34530062-34530084 AATCTCATGAAAAAACTAATGGG + Intergenic
952937487 3:38411663-38411685 ATTCTCATGTAGAATAGGAAAGG - Intronic
954471668 3:50702091-50702113 ATTTCTGTGAAGAATATAATTGG + Intronic
955584868 3:60465911-60465933 ATTTTCATGAAGAATGTCATTGG + Intronic
955595502 3:60586004-60586026 CTTCTCATGGAGAATCTCATTGG + Intronic
956541272 3:70342630-70342652 ATTCTGCTGAAGCATATAACAGG + Intergenic
956849489 3:73215612-73215634 ATTCTGATGTACAAAATAATAGG - Intergenic
957742489 3:84289648-84289670 TTTATCAGTAAGAATATAATAGG + Intergenic
957977493 3:87465864-87465886 ATTTCCATGAAGAATGTCATTGG - Intergenic
958107714 3:89098745-89098767 ATTCTCATGAACATTTTCATGGG + Intergenic
958581337 3:96028613-96028635 ATTATGATAAAAAATATAATGGG - Intergenic
959301056 3:104601844-104601866 ATTAACATGAAGAAAATATTGGG - Intergenic
959729373 3:109583543-109583565 ATTCTCAGCATGAAGATAATAGG - Intergenic
959804511 3:110535025-110535047 ATTTCTATGAAGAATATAATTGG - Intergenic
960323717 3:116268840-116268862 ATTTTCATGGAGAATAGAAATGG + Intronic
960566419 3:119137189-119137211 ATTTCTGTGAAGAATATAATTGG - Intronic
962615677 3:137124108-137124130 ATTCTATATAAGAATATAATTGG - Intergenic
965961417 3:174432661-174432683 TTCCTCATGAAGAATCCAATGGG - Intergenic
966310541 3:178588826-178588848 CTCCTCATGAAGAAAATAAGAGG + Intronic
966444035 3:179980604-179980626 ATATTCATGAAGAATATGGTAGG - Intronic
966572292 3:181458562-181458584 TAACTCATGAAGAATATAAAAGG - Intergenic
966652187 3:182314121-182314143 CTTCTCATGAAGTATCTTATTGG + Intergenic
969727985 4:8936278-8936300 ATTTATATGAAGAATATCATTGG - Intergenic
970985586 4:22153115-22153137 ATTTTTATGAAGAATGTCATTGG - Intergenic
972236760 4:37143743-37143765 ATTTCCATGAAGAATGTCATTGG + Intergenic
972302942 4:37802685-37802707 ATTCACATAAAGAATTTTATTGG - Intergenic
972970167 4:44565036-44565058 ATTTCTATGAAGAATATCATTGG - Intergenic
973049798 4:45582493-45582515 ATTCCTCTGAAGAATATCATTGG + Intergenic
973088941 4:46107064-46107086 AATAACTTGAAGAATATAATTGG - Intronic
973577073 4:52301007-52301029 ATTCTCATGAAAACTCTATTAGG - Intergenic
974543598 4:63271439-63271461 ATTCTCATGTTGAATGTTATTGG + Intergenic
974772018 4:66428033-66428055 ATTTCTATGAAGAATATCATTGG - Intergenic
974837628 4:67269943-67269965 ATTCTCTTTGAGAATAAAATGGG + Intergenic
974892929 4:67903259-67903281 ATTTTTGTGAAGAATATCATTGG + Intergenic
975343062 4:73262667-73262689 TTTCTCCTGAAGACTAGAATTGG + Intergenic
975409658 4:74035565-74035587 ATTTTCTGGAAGAATATAAATGG + Intergenic
975451079 4:74527530-74527552 ATTCTCATTCAGAAAAAAATGGG + Intergenic
975532036 4:75409954-75409976 ATTTTTATGAAGAATGTCATTGG + Intergenic
975934568 4:79562648-79562670 ATTCTAAGGAAGAATGTAAGGGG - Intergenic
976968338 4:91073562-91073584 ATTTTTATCAACAATATAATTGG + Intronic
977383165 4:96303422-96303444 ATTGTCGTGAAGAACATAAATGG + Intergenic
978155285 4:105482821-105482843 AATGACATGAAGAATATATTTGG - Intergenic
978315816 4:107435783-107435805 AATTTCATGAAGAATGTAATTGG - Intergenic
978984886 4:114999684-114999706 ATTCTCAGCAAGAAAATAAAAGG - Intronic
979020659 4:115493092-115493114 CTCCTAATGGAGAATATAATTGG + Intergenic
979377975 4:119970716-119970738 ATTGTTGTGAAGAATATCATTGG + Intergenic
979612028 4:122699459-122699481 ATTTTCATGTAGAATAAAACTGG - Intergenic
979782772 4:124675346-124675368 ATTATCATGAAGAACATATGAGG + Intronic
980690418 4:136289614-136289636 ATTCTTAAGTAGAATATTATTGG - Intergenic
980797860 4:137708890-137708912 ATTCATATGCAGAATATAAAAGG - Intergenic
980867899 4:138575159-138575181 ATCTTCATGAAGAAAATATTTGG - Intergenic
982833132 4:160088233-160088255 ATTCACATATAGAATAAAATTGG - Intergenic
982896904 4:160941928-160941950 ATTATTATGAAGAAAATAGTAGG - Intergenic
982983205 4:162167926-162167948 TTTATCATGGAGAATAAAATAGG - Intergenic
983074379 4:163307470-163307492 ATTATCAACAAGAATATCATTGG - Intergenic
983261842 4:165465747-165465769 TTTTTCATGAAGACTATAAGAGG + Intronic
983624552 4:169789701-169789723 AATATCATGAACAATATTATAGG + Intergenic
984027797 4:174565738-174565760 AATTTCATGAAGAATGTCATTGG - Intergenic
984302886 4:177946365-177946387 ATTCTCATGAGGGATTTTATAGG + Intronic
985052527 4:186006575-186006597 CTTCTTGTGAAGAATATTATTGG + Intergenic
985208128 4:187562654-187562676 ATTCTCATGCAGAATTTACAGGG - Intergenic
986587869 5:9337270-9337292 ATCCTACTGAAGAATATAGTGGG + Intronic
986842442 5:11713645-11713667 ATCCTCATGATGAAAATACTAGG - Intronic
987566280 5:19591329-19591351 ATTCAAATGAAGACTATATTAGG + Intronic
987701410 5:21404472-21404494 ATTCTAATGAATATTAAAATGGG + Intergenic
987801764 5:22706907-22706929 TTTCTTAGGAAGAATGTAATGGG - Intronic
987838397 5:23190628-23190650 AATCTCATGAAGAAAGTCATTGG - Intergenic
987895844 5:23944903-23944925 ATGGTAATGAATAATATAATTGG - Intergenic
987906062 5:24078880-24078902 ATTTTCATGACAAATATATTTGG - Intronic
987977385 5:25032182-25032204 ATTCTCAGTATGAATATAAAGGG - Intergenic
988131506 5:27112636-27112658 AATTTCATGAAGAATATCAATGG - Intronic
988132679 5:27124857-27124879 ATAATCATGAAGAAAATAACAGG + Intergenic
988221477 5:28351833-28351855 TTGCACATGAAGAATAAAATTGG + Intergenic
988409013 5:30862177-30862199 AATCTCATGAAGAAAATGTTGGG + Intergenic
988542300 5:32121493-32121515 ACTCTTATGAAGACTGTAATTGG + Intergenic
988935650 5:36079760-36079782 ATTCTCATTAACAATAGAATGGG - Intergenic
989748847 5:44866505-44866527 TTTTTCATGAAAAATATAAGTGG + Intergenic
989996914 5:50845922-50845944 ATTCCCAAGAAGAATTTACTGGG - Exonic
991169918 5:63612281-63612303 ATCCTTATGTAGAATATAAGAGG + Intergenic
991267090 5:64732746-64732768 ATTTTGATGAAGAATAAAGTGGG + Intronic
991324177 5:65411488-65411510 ATGCTGATGAAGGAGATAATAGG - Intronic
991336997 5:65559687-65559709 ATCCTCATGAAAAATAAGATGGG + Intronic
992367897 5:76112135-76112157 TTTCTCATGAAGTTTATGATTGG + Intronic
993083216 5:83328696-83328718 ATTCTGAAGAAGAATAAAGTGGG + Intronic
993519225 5:88879465-88879487 ATTTTTATGTAGAATATATTTGG + Intronic
994147895 5:96414976-96414998 ATACTCATGTAGAGTTTAATGGG + Intronic
994654029 5:102566596-102566618 ATTTCTGTGAAGAATATAATTGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
995594024 5:113729704-113729726 ATTCTCATGGAGTATATTAGAGG + Intergenic
995595184 5:113740510-113740532 AATCTTAGGAAGAAAATAATTGG + Intergenic
995819087 5:116206717-116206739 ATATTCTTGGAGAATATAATTGG + Intronic
995872807 5:116760282-116760304 TTTCTCATGAAGAATAGAGCAGG - Intergenic
996533168 5:124547404-124547426 AGTCTCATGAAGAAATAAATAGG - Intergenic
996850614 5:127947512-127947534 AATTTCATGAAGAATATCATTGG + Intergenic
997883389 5:137610667-137610689 ATTTTCATGCAGAATATTACTGG - Intergenic
998293375 5:140939460-140939482 ATTCTCATGAAGAGAATTCTAGG - Intronic
998616092 5:143742291-143742313 ATTTTCAGAAAGAATATATTAGG + Intergenic
999924230 5:156357559-156357581 ATTCTCATGAAAAATTTTAAGGG + Intronic
1000872105 5:166589743-166589765 ATTCTCATTAAATATATTATTGG - Intergenic
1000915616 5:167077557-167077579 ATTATCATAAAGAATATGATCGG + Intergenic
1002404957 5:179023563-179023585 ATTCTAATTACGAATACAATGGG + Intergenic
1003689564 6:8339409-8339431 ATTCCTATGAAAAATATAATTGG - Intergenic
1004760281 6:18658048-18658070 CTTCTCATGAAGAATCTTAGTGG - Intergenic
1004912235 6:20297755-20297777 ATTTCTATGAAGAATACAATTGG + Intergenic
1005420536 6:25643939-25643961 ATTCTCAAAAAGAATACCATGGG + Intergenic
1005593537 6:27353485-27353507 ATTTCTTTGAAGAATATAATTGG - Intergenic
1006193857 6:32225383-32225405 ATTGTCATGAAGGACATTATGGG - Intergenic
1007012271 6:38429126-38429148 ATGCCCATGAAGTATCTAATGGG - Intronic
1008261637 6:49372584-49372606 AGTCTCAAGAAGAAGATAACTGG - Intergenic
1009222789 6:60999551-60999573 AATATCATGAAGCATATCATAGG - Intergenic
1009321783 6:62300012-62300034 ATTTTTATGAAGAATAAAAATGG + Intergenic
1009745311 6:67805728-67805750 ATTTCTATGAAGAATATCATTGG - Intergenic
1010065459 6:71677407-71677429 ATTCTCCTGAAGATTTTAAGGGG - Intergenic
1010127433 6:72449377-72449399 ATTCTAATGAAGGCTTTAATTGG + Intergenic
1010772870 6:79852554-79852576 ATTTCCATGAAGAATGTCATTGG - Intergenic
1010967654 6:82230443-82230465 ATTCTGGAGAAGAATATTATTGG + Intronic
1011322421 6:86110825-86110847 ATTTTTGTGAAGAATGTAATTGG + Intergenic
1012032925 6:94096046-94096068 ATACTCAAGCAGAATATAAATGG - Intergenic
1012236113 6:96818069-96818091 ATTTCTATGAAGAATATCATTGG - Intronic
1012488231 6:99746021-99746043 ATTCTCATTAAGAATCTCAAGGG + Intergenic
1013114354 6:107089931-107089953 ATTTTTGTGAAGAATATCATTGG - Intronic
1013363072 6:109412357-109412379 ATTTCCATGAAGAATGTCATTGG - Intronic
1013426382 6:110016662-110016684 TTTCTCATTAACAATATATTAGG - Intergenic
1013568519 6:111395232-111395254 ATTTCCATGAAGAATGTCATTGG + Intronic
1013742755 6:113307183-113307205 TTTCTCATGAAAAAAATAATAGG + Intergenic
1013873642 6:114798090-114798112 AATTTCATGAAGAATATACCCGG - Intergenic
1014093092 6:117427632-117427654 ATTCTCATCAAAAATATACAAGG + Intronic
1014505682 6:122251932-122251954 AACATCATTAAGAATATAATTGG + Intergenic
1015471473 6:133611383-133611405 ATTGCCATGATGAATAGAATAGG - Intergenic
1016991238 6:149930052-149930074 ATTCTCAGCTAGAATATTATTGG - Intergenic
1017178747 6:151529728-151529750 ATTTTCATAAAGGAGATAATTGG + Intronic
1018957801 6:168422522-168422544 ATCCACATGCAGAATAAAATTGG - Intergenic
1021046463 7:15928865-15928887 ATTTCTGTGAAGAATATAATTGG - Intergenic
1021326666 7:19279092-19279114 ATTCTCATGATGTGTATATTGGG + Intergenic
1021542122 7:21771359-21771381 ATTTTCAAGAGGAATATACTGGG + Intronic
1021695467 7:23271834-23271856 TTTCTCATTAATAATATAAATGG + Intronic
1022747690 7:33189465-33189487 AATCTCATGAAGTATTAAATAGG - Intronic
1022780723 7:33579897-33579919 TTCTTCATGAAGAATATACTAGG - Intronic
1024034213 7:45493933-45493955 ATTCTCATGGAGTATATTACTGG + Intergenic
1024127385 7:46314004-46314026 ATTTTTATGGAGAATATTATTGG + Intergenic
1025138540 7:56442113-56442135 ATTTCTATGAAGAATATCATTGG - Intergenic
1027549687 7:79574892-79574914 ATTCTCATGAATATTCTCATGGG + Intergenic
1028051255 7:86190299-86190321 ATCTTCATGAAGAAAATATTTGG + Intergenic
1028156269 7:87433481-87433503 ATTATCATGATGATGATAATAGG + Intronic
1030611003 7:111688741-111688763 AATCTCTTGGAGAATATAATGGG - Intergenic
1031424006 7:121584141-121584163 ATTCTTATCAAGAATATAAAAGG + Intergenic
1031518677 7:122735422-122735444 ATCCTCATGTAGAACACAATGGG + Intronic
1031656438 7:124361719-124361741 ATTTTTGTGAAGAATGTAATTGG - Intergenic
1032634185 7:133688512-133688534 ATACTAATGACTAATATAATTGG - Intronic
1033180334 7:139171308-139171330 ATTTTTATGAAGAATATCATTGG - Intronic
1033246805 7:139723875-139723897 ATTCTCTTGAATAATATAACTGG - Intronic
1033757466 7:144406646-144406668 ATTTACATGAAGAATTTTATTGG + Intronic
1033862022 7:145640278-145640300 ATTCTCATCTTGAATATTATTGG + Intergenic
1033933502 7:146553584-146553606 ATTCTCTTCAAGGAAATAATTGG + Intronic
1034247052 7:149653644-149653666 ATTTCCATGAAGAATGTCATTGG - Intergenic
1035893679 8:3373477-3373499 CTTCTCCTGAAAAATATTATAGG - Intronic
1038669667 8:29572509-29572531 ATTCTAATGACAAATTTAATTGG - Intergenic
1039107763 8:34007651-34007673 ATTCTCCTGAAGACTATGTTTGG + Intergenic
1040909040 8:52499711-52499733 ATGCTCATGAAGAAACTGATGGG - Intergenic
1041323667 8:56640919-56640941 ATTCTGATGAAGAAACTGATAGG - Intergenic
1041479639 8:58305816-58305838 ATTTTCATTAAGAATAAACTTGG + Intergenic
1041484937 8:58365233-58365255 ATTTTGGTGAAGAATATCATTGG - Intergenic
1042572206 8:70177719-70177741 ATTCTTAAAAAGAATAAAATAGG - Intronic
1042758520 8:72245163-72245185 ATTCTCATGAAACATTTAATGGG + Intergenic
1043032856 8:75159837-75159859 ATTTTTATGAAGAATGTTATTGG + Intergenic
1043088111 8:75862544-75862566 ATTGCCATGAAGAAAATATTGGG - Intergenic
1043295593 8:78658798-78658820 ATGCTAATTAATAATATAATTGG - Intergenic
1043600630 8:81933420-81933442 ATTTCCATGAAGAATGTCATTGG - Intergenic
1043677581 8:82977232-82977254 ATACTCATTAAGAAAATAAAAGG - Intergenic
1044160251 8:88904707-88904729 ATTCTTGTGAAGAATATCATAGG - Intergenic
1044673569 8:94708093-94708115 ATGCTTATGAAGAACATACTGGG - Intergenic
1045707160 8:104937675-104937697 ATACTGAAGAAGAATATAATTGG - Intronic
1046087285 8:109454089-109454111 ATTGTAATGAATAATTTAATAGG + Intronic
1046552798 8:115738018-115738040 ATTCTAATGAAGTATAAGATTGG + Intronic
1047812565 8:128426336-128426358 AGTCACGTGAAGGATATAATTGG - Intergenic
1048676279 8:136785411-136785433 ATTTCTATGAAGAATATCATTGG - Intergenic
1049898361 9:132664-132686 ATCCTCATGAAGCATTTGATGGG + Intronic
1050227887 9:3482042-3482064 ATTCATATAAAGAAAATAATTGG + Intronic
1050393259 9:5168734-5168756 CTTCTCATGAAGTATCTTATTGG - Intronic
1050631734 9:7566356-7566378 AATCTCAAGAAAAAAATAATCGG + Intergenic
1050751468 9:8943242-8943264 ATTTCTATGAAGAATATAATTGG - Intronic
1051110122 9:13626328-13626350 ATTTTTATGGAGAATATTATTGG + Intergenic
1051200520 9:14616338-14616360 ATTGACAGCAAGAATATAATGGG + Exonic
1051733104 9:20168235-20168257 AATCTGATAAAGAGTATAATTGG + Intergenic
1052285237 9:26777185-26777207 ATTCTCAGGAAGAATATTAGAGG - Intergenic
1052425403 9:28298148-28298170 ATTCTCATTAATAACATATTTGG - Intronic
1053273294 9:36765037-36765059 ATTGTCATGAAGGATAAGATTGG + Intergenic
1053741424 9:41142965-41142987 ATCCTCATGAAGCATTTGATGGG + Intronic
1054346637 9:63972452-63972474 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054444414 9:65299112-65299134 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054485858 9:65722389-65722411 ATCCTCATGAAGCATTTGATGGG - Intronic
1054686924 9:68288336-68288358 ATCCTCATGAAGCATTTGATGGG - Intronic
1055461924 9:76527727-76527749 TTACTTATGAAGAATATAATGGG - Intergenic
1055959495 9:81807002-81807024 ATTCTTAAGAAGAATAGAAAAGG + Intergenic
1056228893 9:84525110-84525132 ATTTTTGTGAAGAATATCATTGG + Intergenic
1056413259 9:86353417-86353439 ATTTTCATGAAGAATATTAGAGG - Intronic
1056989415 9:91396747-91396769 TTTCTCACAAAGAATTTAATAGG + Intergenic
1058036876 9:100262274-100262296 ATTCTCTTGGAGAATAAAATTGG + Intronic
1058070324 9:100595070-100595092 TTTCTCATTAATAAGATAATAGG + Intergenic
1059732790 9:117073485-117073507 ATTGTGATAAATAATATAATGGG - Intronic
1060097219 9:120802457-120802479 ATTTCCATGAAAAATATCATTGG + Intergenic
1185853616 X:3511894-3511916 ATTTTCATCAAAAACATAATTGG + Intergenic
1188288606 X:28360861-28360883 ATTATATTGAAAAATATAATAGG + Intergenic
1188298312 X:28477490-28477512 ATTTTTGTGAAGAATATCATTGG + Intergenic
1188733492 X:33682572-33682594 TTTTCTATGAAGAATATAATTGG + Intergenic
1188752000 X:33915917-33915939 ATTCTAATGAAGAAACTGATGGG + Intergenic
1188788282 X:34375986-34376008 ATTAACTTGAAGAGTATAATTGG + Intergenic
1188938852 X:36212631-36212653 ATTATCAAAAAGAATAAAATAGG - Intergenic
1189143540 X:38632245-38632267 ATTCTCCTGGACAATATTATAGG + Intronic
1189162856 X:38828798-38828820 ATTGTCATAAAGAATGTCATTGG - Intergenic
1189354904 X:40303158-40303180 TTTCTCATGCAGAATAAAAAGGG + Intergenic
1189361532 X:40357263-40357285 ATACTCATTAACAATAGAATGGG + Intergenic
1189455030 X:41179283-41179305 ATTTCTGTGAAGAATATAATTGG + Intronic
1190100441 X:47518583-47518605 ATTCTGATCCAGAATATATTAGG + Intergenic
1190588645 X:51974346-51974368 AATCTCTTGAACAATATAAGAGG + Intergenic
1190633874 X:52415558-52415580 ATGCTAATGAAGTACATAATAGG - Intergenic
1190637798 X:52453635-52453657 ATGCTAATGAAGTACATAATAGG - Intergenic
1190811124 X:53884749-53884771 ATTCCCATGAAAAATATGATTGG + Intergenic
1190943107 X:55063124-55063146 ATTTATATGAAGAATATCATTGG + Intergenic
1190953369 X:55168064-55168086 ATGCTAATGAAGTACATAATAGG + Intronic
1191222711 X:58006924-58006946 ATTTTTGTGAAGAATATCATTGG - Intergenic
1191957452 X:66660455-66660477 ATTTCTATGAAGAATATTATTGG - Intergenic
1193284922 X:79700813-79700835 CTTATAATTAAGAATATAATTGG - Intergenic
1193529304 X:82636766-82636788 ATTTCCATGAAGAACATCATTGG + Intergenic
1193915827 X:87362471-87362493 ATTTCTATGAAGAATGTAATTGG - Intergenic
1194177367 X:90666713-90666735 CTTCTCATGAAGTATTTTATTGG - Intergenic
1194382204 X:93207962-93207984 ACTTCTATGAAGAATATAATAGG - Intergenic
1194478536 X:94390797-94390819 ATTTCCATGAAGAATGTCATTGG + Intergenic
1194559782 X:95405778-95405800 ATTTTTGTGAAGAATATCATTGG - Intergenic
1196098268 X:111822869-111822891 ATTGTCATGAAGACTATCTTGGG - Intronic
1196780517 X:119379617-119379639 AATGTCATCAAGAATAAAATGGG + Intergenic
1197046309 X:122002830-122002852 ATTCTCATGGAGTATCTAAGTGG + Intergenic
1197318109 X:124993196-124993218 AATTTCATGAAGAATATCTTTGG + Intergenic
1197552362 X:127908040-127908062 ATTCTACTGAAGAAAAAAATGGG - Intergenic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1197658275 X:129141912-129141934 TTTCTCATGAAAAATCTACTGGG + Intergenic
1200524041 Y:4248859-4248881 CTTCTCATGAAGTATCTTATTGG - Intergenic
1200809831 Y:7472621-7472643 ATTTTCATCAAAAACATAATTGG - Intergenic