ID: 949774714

View in Genome Browser
Species Human (GRCh38)
Location 3:7619753-7619775
Sequence CTGATAAAGAAGTTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949774711_949774714 -7 Left 949774711 3:7619737-7619759 CCAATGGAATGCATATCTGATAA 0: 1
1: 0
2: 0
3: 21
4: 152
Right 949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG 0: 1
1: 0
2: 3
3: 13
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949774714 Original CRISPR CTGATAAAGAAGTTGGGACA AGG Intronic
902320092 1:15656227-15656249 CTGAGAAAGAAATTTGGAAAGGG + Intronic
903231273 1:21923714-21923736 CTGGTAAAGGAGTAGGGAGAAGG - Intronic
903922577 1:26811063-26811085 CTGATACAGAAATTGGTACTAGG + Intergenic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
908579018 1:65493966-65493988 CAGAGTAAGAAGTTGGCACAAGG + Intronic
908940172 1:69422717-69422739 CTGCTAAAGAAACTGTGACAAGG - Intergenic
909940529 1:81605952-81605974 TTAATAAAGAGGTTGGGATAAGG - Intronic
911119742 1:94283857-94283879 CCGATAAAGATGTTTGGAAATGG - Intergenic
913071404 1:115302306-115302328 CTCATAAAGAAGGTGGAACGAGG - Intronic
913693232 1:121299616-121299638 CTGCTTAAGCAGTCGGGACAGGG + Intronic
914144324 1:144980464-144980486 CTGCTTAAGCAGTCGGGACAGGG - Intronic
915986007 1:160465429-160465451 CGGATAACGAAGTCGGGAGATGG + Intergenic
916247257 1:162701023-162701045 CTGATAAATAATTTAGGACTTGG + Intronic
917068740 1:171126053-171126075 CTGATACAGAAGTTGGTGCCAGG - Intergenic
917093776 1:171380287-171380309 CTGGTAAAGATGTAGGGAAATGG - Intergenic
918015245 1:180627238-180627260 CTGATAAAGAAGATGGGTCAAGG - Intergenic
919558131 1:199086787-199086809 CTGAGAAAGAAGTAGGGAAAAGG - Intergenic
919914084 1:202129432-202129454 CTAACAAGGAGGTTGGGACAGGG - Exonic
920480554 1:206317985-206318007 CTGCTTAAGCAGTCGGGACAGGG + Intronic
921055753 1:211541318-211541340 CTGAGCAAGAAGGTGGGAAATGG - Intergenic
921188675 1:212691188-212691210 CTGGTAAAGAAGTGGGTACCAGG + Intronic
921609854 1:217198777-217198799 TTGATACAGAACTTGGTACAAGG - Intergenic
1063907007 10:10791419-10791441 ATGATTTAAAAGTTGGGACATGG - Intergenic
1064565084 10:16631759-16631781 GGGACAAAGAAGTTGGGGCAAGG - Intronic
1064744600 10:18465974-18465996 TTTATAAAGAAGTTGGGGCCGGG - Intronic
1065398551 10:25269084-25269106 CTGGCAAAGAAGCTGGCACATGG + Intronic
1069085285 10:64131725-64131747 GTGATAAAGAAAATGGGAAATGG - Intergenic
1070904506 10:80059850-80059872 TTGATAAAGAATCTGGGCCAGGG - Intergenic
1074083465 10:110186709-110186731 CTGATAAGGATGTGGGGAAATGG - Intergenic
1076079782 10:127568698-127568720 CTGAGACAGATGTTGGAACAAGG + Intergenic
1076159534 10:128232807-128232829 GTAATGAAGAACTTGGGACAGGG + Intergenic
1076283199 10:129268274-129268296 CTGTTAAACAACTTGGGTCAAGG - Intergenic
1078397786 11:10996882-10996904 CTGATATAGATGTTGGTACCCGG - Intergenic
1078892725 11:15572125-15572147 AAGAAAAAGAAGTTGGGAAATGG + Intergenic
1079501145 11:21102500-21102522 CAGATAAAGAAATTGAGACATGG - Intronic
1080738153 11:35037591-35037613 CTGGTATAGAAGTTGGGAAGAGG + Intergenic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1081284267 11:41248190-41248212 TTGGTAAAGAAGTTAGGACTTGG - Intronic
1081342747 11:41947831-41947853 ATGATACAGAAGCGGGGACAGGG - Intergenic
1083650050 11:64197831-64197853 CTGATAAAGAAAGAGGGACAAGG - Intronic
1086146002 11:83552499-83552521 CTCATAAAGAAGTTGGTGAATGG + Intronic
1086261870 11:84949367-84949389 TTGCTAATGAAGTTGAGACAGGG + Intronic
1086923471 11:92614381-92614403 TTGATAAAAATGTTGGGAAATGG - Intronic
1087122298 11:94587757-94587779 CTAATAAAGAAGGTGAGACATGG - Intronic
1087765392 11:102146603-102146625 ATGCTACAGAAGTTGGGATAAGG - Intronic
1089727712 11:120497107-120497129 CGGATCAAGAGGTTGGGAGATGG + Intergenic
1090682141 11:129072513-129072535 CTGTTACAGAAGTGGGGTCACGG + Intronic
1092803821 12:12200184-12200206 CTGTTAATGAAGTTGTGGCAGGG - Intronic
1092908736 12:13126084-13126106 CTGATAATGAGGCTGGGGCAAGG - Intronic
1099203107 12:79698416-79698438 CTAGTAAGGAAGTTAGGACATGG - Intergenic
1101973028 12:109330583-109330605 CTGATATACGAATTGGGACAGGG - Intergenic
1102890215 12:116552841-116552863 CTGAGGAAGGAGTGGGGACAGGG + Intergenic
1103224310 12:119274027-119274049 CTGATATGGGAGTTGGGGCAGGG + Intergenic
1104881365 12:132073318-132073340 CTGATACAGAAGTGTGCACATGG - Intronic
1105628895 13:22141477-22141499 CTGACAATGGAGATGGGACACGG - Intergenic
1107457150 13:40565404-40565426 CTGAGACAGAAGCTGGGGCATGG - Intronic
1107871871 13:44754244-44754266 TTGGAAAAGAAGTTGGGAGATGG + Intergenic
1110429746 13:75410505-75410527 TTGCTGAAGAAGTTGGGTCAGGG + Intronic
1110951434 13:81497338-81497360 CTGATTATGAAGTTGAGATAAGG + Intergenic
1111156838 13:84338419-84338441 GTGATACAGAAGGAGGGACAGGG - Intergenic
1111474792 13:88729987-88730009 CTGATAAAGATTTTGAGACCAGG - Intergenic
1111619020 13:90699688-90699710 CTGAGAAAGAAATTGGTACTGGG + Intergenic
1112586653 13:100724234-100724256 CTTATAAAGAGGTTGGCTCATGG - Intergenic
1113289017 13:108884949-108884971 GTGATAAAGATGCTGAGACAGGG + Intronic
1114028669 14:18555379-18555401 CAGATACAGAATTTGGGAGATGG - Intergenic
1115060799 14:29187538-29187560 CAGAAAAAGAAGCTGGGAAAGGG - Intergenic
1115607161 14:35014809-35014831 CTTATAGAGAAGTTGAAACATGG + Exonic
1117390583 14:55258620-55258642 CGGATCAAGAGGTTGGGAGATGG + Intergenic
1118386142 14:65257071-65257093 CTGATAAAACACTTGGGACTTGG + Intergenic
1118730667 14:68663869-68663891 CTGACAAAGAATTTGTGAGAGGG - Intronic
1118827933 14:69400688-69400710 GTGGGAAAGAAGGTGGGACAAGG + Intronic
1120331200 14:83094525-83094547 ATGAGAAAGAAGGTGGGAGATGG + Intergenic
1120543525 14:85781321-85781343 CAGATATAGGAGCTGGGACAAGG - Intergenic
1120738832 14:88085154-88085176 TAGATAAGGAAATTGGGACATGG + Intergenic
1121746555 14:96299480-96299502 CTAATATAAAACTTGGGACAAGG + Intronic
1125282323 15:38056028-38056050 CTGATAGAGAATTTGGGTCCTGG - Intergenic
1126994566 15:54425975-54425997 CTGACAAAGAATTTGGAAGATGG - Intronic
1127234847 15:57038109-57038131 CTGATTAGGAAGCTGGGATAGGG + Intronic
1128966942 15:72068775-72068797 TTGGTAAAGAAATTGGGATATGG - Intronic
1129613137 15:77076543-77076565 CTTTTAAAGAGCTTGGGACATGG - Intronic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135181929 16:20282478-20282500 CTGAGAAATAAGTTTGGAGAGGG + Intergenic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1137856558 16:51800333-51800355 CAGATGAAGAAATGGGGACAAGG + Intergenic
1139313185 16:66044284-66044306 CTCATTAAGAAGTTGGCACCTGG - Intergenic
1140715301 16:77721033-77721055 CTGATTCAGCAGTTGTGACATGG + Intergenic
1143568236 17:7738145-7738167 CTGACAAGGGAGTTGAGACATGG - Intronic
1144342825 17:14324340-14324362 TGGAGAAAGAAGTGGGGACAAGG - Intronic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1147846939 17:43411114-43411136 AAGAGAAAGAAGGTGGGACAAGG - Intergenic
1148904320 17:50902255-50902277 CTTCTAAAGAAGGTGGAACATGG + Intergenic
1153255796 18:3169654-3169676 CTGACAAAGATGTGGAGACAAGG + Intronic
1158667401 18:59444875-59444897 CTGATTAAAAAGATGGGAAAAGG - Intronic
1159667436 18:71179275-71179297 CTGATACAGAAATTGGTACCAGG + Intergenic
1160226983 18:77019245-77019267 CAGGTACAGAAGTTAGGACATGG - Intronic
1160541884 18:79628449-79628471 CTGACACAGCAGTGGGGACAGGG + Intergenic
1161738422 19:6005770-6005792 CAGAAGAAGAAGCTGGGACATGG - Intronic
1165198423 19:34125508-34125530 TTTATAGAGAATTTGGGACATGG - Intergenic
1166096894 19:40545543-40545565 CTGGCAAAGATGTTGGGAGATGG - Intronic
1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG + Intronic
1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG + Intronic
1166494782 19:43291891-43291913 CTGAGAAAGAATTCAGGACATGG + Intergenic
925921889 2:8644161-8644183 CTGATGAAGGGGTTGGCACATGG - Intergenic
925923968 2:8657604-8657626 CAGATGAAGAAGACGGGACAGGG + Intergenic
926493449 2:13554712-13554734 CTGATGTAGAAGTTGCAACAAGG - Intergenic
929394400 2:41506215-41506237 TTGATAAGGATGTTGGGATAAGG - Intergenic
929794919 2:45051809-45051831 CAGATAAAGAAGCTGAGACTCGG + Intergenic
929955076 2:46451704-46451726 CTGAGAAGAAAGTTGGGAGAGGG + Intronic
933815975 2:86069156-86069178 CTGAAAAAGTACTTGGGAAATGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936650628 2:114422382-114422404 CTGATGAAGAAGTGGGGATGAGG - Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
940205406 2:151196525-151196547 TTGGGAAAGAAGTTGGGGCATGG - Intergenic
940634210 2:156277658-156277680 CTAATAAAGAAGGTGGTTCAAGG - Intergenic
942220552 2:173764991-173765013 CTGATAAGGAAATAGGAACATGG - Intergenic
943884659 2:193200357-193200379 CTTATAAAGAACTTGGGTAAGGG + Intergenic
944145514 2:196503484-196503506 CAGAAAAAGAACTAGGGACAAGG + Intronic
946479758 2:220043365-220043387 CTGATAAAGAAGTCATCACAAGG - Intergenic
946655117 2:221937955-221937977 TTGAAAAAGAAGTTTGGCCAGGG + Intergenic
946798449 2:223382810-223382832 ATAATAAAGAAATGGGGACAAGG + Intergenic
948163633 2:235844649-235844671 ATGAGACAGAAGCTGGGACAGGG - Intronic
948405348 2:237713189-237713211 CTGATAATGCTGTGGGGACAGGG - Intronic
1171317086 20:24204827-24204849 CTGAGAGTGAGGTTGGGACAAGG - Intergenic
1171329978 20:24329026-24329048 GTGATAAGGAAGTTGGGAAGAGG - Intergenic
1172616120 20:36285981-36286003 CTGACAAAGAAGCTGCGTCAGGG - Intergenic
1175022627 20:55866528-55866550 CAGATAAAGAAGTTAAGGCATGG + Intergenic
1178679662 21:34662898-34662920 CTGATAAAGATGTGGTGAAAAGG + Intergenic
1179397794 21:41057223-41057245 CAGATAAATAAGTTGGGAGTTGG - Intergenic
1180452789 22:15482429-15482451 CAGATACAGAATTTGGGAGATGG - Intergenic
949201348 3:1383533-1383555 CAGAGAATGAAGTTGAGACAGGG + Intronic
949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG + Intronic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951851839 3:27150196-27150218 CTGATATAGAAGTTGCAGCAAGG + Intronic
953290029 3:41651036-41651058 GAGATAAAGAAGTAGAGACAGGG - Intronic
954704669 3:52473051-52473073 CAGATAAGGAAGTTTGGCCAGGG + Intronic
954915173 3:54142737-54142759 CTGATGAAGAAGCTGAGGCATGG + Intronic
956260446 3:67334616-67334638 CTGATAAAGAAAGGGGGAAATGG + Intergenic
956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG + Intergenic
957515973 3:81251403-81251425 CTGGTACAGGAGTGGGGACATGG - Intergenic
957579332 3:82050527-82050549 TTGATAAATATGTTGGGAGAGGG + Intergenic
957834519 3:85569553-85569575 CTGGCAAAGATGTGGGGACAGGG - Intronic
958804052 3:98788062-98788084 ATGAAGAAGAAGTTGGGAGAAGG + Exonic
959363606 3:105427461-105427483 GTGATGAAGCAGTGGGGACAGGG - Intronic
959732241 3:109617920-109617942 CTGATAAAGAAATTGAGGAATGG - Intergenic
960199503 3:114813416-114813438 ATAGTAATGAAGTTGGGACAGGG - Intronic
961378081 3:126480265-126480287 CTGAAAAAGAAGATGGCACTGGG + Intergenic
961800447 3:129444366-129444388 CTGATAAAGAAGCTGGAACAAGG - Intronic
963539589 3:146567967-146567989 CTGATAAGTAAATTGGTACAGGG - Intergenic
963986982 3:151607608-151607630 ATGATTAAGAAGTGGGAACATGG + Intergenic
966189465 3:177259000-177259022 CTGCAAAAGAAGTTGGCACCCGG - Intergenic
966521790 3:180881555-180881577 CTGAGAAAGAATTCAGGACATGG - Intronic
969895278 4:10298245-10298267 CTGATAAAGTGGATTGGACATGG - Intergenic
971109103 4:23562547-23562569 CTGATAAAGATGTGGAGAAAGGG - Intergenic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
975017158 4:69436682-69436704 CTGATAAGGAAATGAGGACAAGG - Intergenic
975310215 4:72895809-72895831 CAGATAAAGACATTGAGACATGG + Intergenic
976125406 4:81829000-81829022 AAGATAAAGAAGTTGGACCATGG + Intronic
976708213 4:88041215-88041237 CTGATTTGGAAGTTGGGGCAAGG - Intronic
977005858 4:91569143-91569165 ATGATACAGCAGTTGGCACATGG + Intronic
977471008 4:97442995-97443017 CTGGTAAAGAAATTCAGACATGG + Intronic
977476839 4:97521773-97521795 ATGATAATTAAGTTGGGACATGG - Intronic
979157740 4:117418981-117419003 ATCATAAACAAGTAGGGACAGGG - Intergenic
981816701 4:148839171-148839193 CTAATAAAGATTTTGGAACATGG + Intergenic
982015034 4:151145061-151145083 CTGACAAAGATGTTGGGAAATGG - Intronic
982320362 4:154070897-154070919 CAGATGAAGAAACTGGGACATGG - Intergenic
983270584 4:165557135-165557157 CCGAGAAAGAATTTAGGACATGG + Intergenic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
988596531 5:32597429-32597451 CTGATAAACAAAATGGGAGAGGG - Intronic
988618984 5:32803155-32803177 CTGAGAAAGAATTCAGGACATGG - Intergenic
989198938 5:38743760-38743782 CTGATACAGAATTTGGTACCAGG - Intergenic
990514346 5:56517892-56517914 CTCCTCAAGAAGTTGGGATATGG - Intronic
990736404 5:58868422-58868444 AGGATAAAGAAGTGGTGACATGG + Intergenic
991527653 5:67579714-67579736 CTGATAATGAATTTGGGAACTGG - Intergenic
991650386 5:68846704-68846726 CAGATAAAGAAATTGGGATATGG + Intergenic
993199377 5:84793725-84793747 CTGAAAAAGGGGGTGGGACAAGG - Intergenic
993754608 5:91712871-91712893 CTGATAAAGATGATGTAACAGGG - Intergenic
994229699 5:97299012-97299034 CTGAGAAAGAATTCAGGACACGG + Intergenic
999228840 5:150049511-150049533 CTGTTAAAGTAGTTGGGAACTGG - Intronic
999278686 5:150350034-150350056 CTGAGAAAGAAGGTGGGAGGGGG + Intergenic
1000938265 5:167329190-167329212 CTTGTCAAGAAGTTTGGACATGG + Intronic
1000939849 5:167347526-167347548 CTAGTAAAGTAGCTGGGACATGG - Intronic
1002411795 5:179085034-179085056 CTGATACAGAACTTGGTACTTGG + Intergenic
1002783802 6:386186-386208 CTGATAAAGAAGTGAGGAGGAGG - Intergenic
1003290967 6:4777190-4777212 TTGATAAAGCATTTGGGAGAGGG + Intronic
1004029429 6:11851765-11851787 CTGATACAGCAGTTGGAACTGGG - Intergenic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1004349131 6:14875694-14875716 CTGATAAAAAGGCTGAGACATGG + Intergenic
1008946725 6:57105904-57105926 TTGATAAAGAAGCTGCCACACGG - Intronic
1010528713 6:76940172-76940194 CTGATAAGGAAGTGGTGAAACGG + Intergenic
1011110187 6:83828968-83828990 CGGATAAGGAAATTGGAACAAGG - Intergenic
1012000247 6:93645417-93645439 CTGATAAAAATGAGGGGACAGGG + Intergenic
1012184654 6:96197733-96197755 CTGCTAATGATGTTGGGATAGGG + Intronic
1013343421 6:109237159-109237181 CTGATATAGGAGGTGGGTCAGGG - Intergenic
1015522138 6:134142163-134142185 CTGTAAAAGACGTTGGGACAGGG + Intergenic
1017381717 6:153839058-153839080 CTAATAAAGTAGTTGGTACATGG + Intergenic
1018544566 6:164920379-164920401 CTGTTTAAGAAGTCAGGACATGG + Intergenic
1022070347 7:26907771-26907793 CTGATAAAGAAAATGGTACTAGG + Intronic
1023358727 7:39394540-39394562 CAGAGAAAGAAGGTGGGAGAAGG - Intronic
1023891187 7:44393088-44393110 GTGAGGAAGAAGTGGGGACAGGG - Intronic
1025119764 7:56291440-56291462 CTGATCATGAAGTAGGCACAGGG - Intergenic
1025185120 7:56851626-56851648 CTGATGAAGCAATTGGGAAATGG + Intergenic
1026309876 7:69174207-69174229 ATGAGAAAGATGTTGAGACAGGG - Intergenic
1026651911 7:72223082-72223104 CTGTTAAAGCAGTTGGCACTGGG + Intronic
1028041576 7:86060349-86060371 CTGATAAAGACGTGGAGAAAAGG - Intergenic
1028280116 7:88914189-88914211 ATGAAAAAGAAGTTTGGAAATGG + Intronic
1028904374 7:96136626-96136648 CTGATAAAGAAGTCAGGGCCAGG + Intronic
1028933883 7:96444138-96444160 ATGATACAGAACCTGGGACACGG - Intergenic
1029317728 7:99729647-99729669 TTGATCAATCAGTTGGGACAGGG - Intronic
1029611689 7:101629972-101629994 CTGATACAGGAGGGGGGACAGGG - Intergenic
1030665199 7:112269765-112269787 TTGATAAAGAAGGTGGGATTAGG - Intronic
1033356833 7:140607122-140607144 CTGAAGAAGGAGTTGGGAGAGGG - Intronic
1034402466 7:150873086-150873108 CTGATACAGAAGTAGAGAGAAGG - Intergenic
1034935805 7:155199925-155199947 CTTATGAAGACGTTGGGACTTGG + Intergenic
1036058551 8:5288802-5288824 CGGATCACGAAGTTGGGAGATGG + Intergenic
1037788017 8:21913909-21913931 CAGGTACAGAAGTTGGCACAGGG + Intergenic
1037924354 8:22832886-22832908 CTGATAAAGGAGATGGGTGAGGG - Intronic
1038049274 8:23793762-23793784 CACATAAAGAAGTTGGAACTTGG - Intergenic
1038514735 8:28177314-28177336 CTGATATCAAAGTTGGGAAAAGG - Intronic
1039339801 8:36635266-36635288 ACAATAAAGAAGTTGGGACCTGG + Intergenic
1041343811 8:56874334-56874356 CTGAAAAACAAGATGGGACCTGG - Intergenic
1041733567 8:61087148-61087170 GAGAGAATGAAGTTGGGACAAGG + Intronic
1043619040 8:82165020-82165042 CAGGTAAAGAAGATGGGAGAAGG + Intergenic
1043642596 8:82474131-82474153 CTGAAAAAGATAGTGGGACAGGG + Intergenic
1043852734 8:85233188-85233210 GTGACAGGGAAGTTGGGACAGGG + Intronic
1044560717 8:93609290-93609312 CTGTTGAAGAAGTTGAGACTTGG - Intergenic
1044979419 8:97700718-97700740 CAGATGAAAAAGTTGTGACAAGG + Intronic
1045609724 8:103824676-103824698 CTGGTATAGAAAGTGGGACATGG + Intronic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1049601295 8:143508919-143508941 CTGGAAAAGAATTTGGGAAATGG - Intronic
1049994571 9:1022568-1022590 CGGATAAACAAGTTGTGATATGG - Intergenic
1050212824 9:3282728-3282750 CAAATAAAGAAGGTGGGAAAGGG - Intronic
1050320430 9:4446804-4446826 ATGAGAAAGAATTTGGGACCAGG - Intergenic
1052134841 9:24897357-24897379 ATGATACAGAAGTGGAGACATGG + Intergenic
1052301234 9:26954975-26954997 ATGAAAAAGAAATGGGGACAGGG + Intronic
1055002184 9:71464045-71464067 GTGCCAAAGAAGTTGGGGCAAGG + Intergenic
1055682382 9:78729902-78729924 CTGATAAAGATGTGGAGAAATGG + Intergenic
1056775503 9:89509417-89509439 CAGAAGAGGAAGTTGGGACATGG - Intergenic
1057066375 9:92055996-92056018 CTGATAACAAAGCTGGGAGAAGG + Intronic
1057988533 9:99742860-99742882 CTGATACAGATTTGGGGACAAGG + Intergenic
1058978536 9:110147426-110147448 CTCATAAAAATGTTGAGACAGGG + Intronic
1060329735 9:122656159-122656181 TTGATGAAGAAGATGGCACAGGG + Intergenic
1061165603 9:128920465-128920487 CTGATAAAGAGCTTGGCACCAGG - Intergenic
1061841189 9:133359456-133359478 GTGAGAAGGGAGTTGGGACAAGG - Intronic
1185861476 X:3583435-3583457 CTAATAGAGCAGATGGGACAGGG - Intergenic
1186557943 X:10580737-10580759 CTGATCAGGAAGTGGGGAAAAGG - Intronic
1187070381 X:15881565-15881587 CTGATACAGAAGTTGGGAGAGGG + Intergenic
1187506101 X:19879806-19879828 CTGATAATGAAGTAAGGAAATGG + Intronic
1187793041 X:22971448-22971470 CTGTTACAGAATTTGGGAAAGGG + Intergenic
1188079639 X:25820994-25821016 CTGGTGAAGATGTTGGGATATGG - Intergenic
1190484412 X:50910549-50910571 CAGAAACAGAAGGTGGGACAAGG - Intergenic
1192181204 X:68916850-68916872 CAGATAAGGAAATTGAGACATGG + Intergenic
1192559290 X:72115135-72115157 CAGGGAAAGAAGTTGGGACATGG - Intergenic
1194709413 X:97216882-97216904 CTAATACAGTAGTTGAGACAAGG - Intronic
1196287421 X:113898543-113898565 CTGAGAAAAAATTCGGGACATGG + Intergenic
1196917621 X:120554710-120554732 CAGAGAAAGAGGGTGGGACAGGG + Intronic
1197756962 X:130002378-130002400 CTGAGAGAGAAGGTGGGGCAGGG + Intronic
1198891900 X:141405841-141405863 CTAATAAGGAAGCTGGGACAAGG + Intergenic
1199426301 X:147704646-147704668 CAGATAAGGAAATTGAGACATGG + Intergenic
1200803053 Y:7403849-7403871 CTAATAGAGCAGATGGGACAGGG + Intergenic
1200887571 Y:8284633-8284655 ATGATTAAGAAGTTGGAATAGGG - Intergenic
1201294239 Y:12450122-12450144 CTGAGAAAGAATTCAGGACACGG - Intergenic
1201982985 Y:19927364-19927386 CTAATTAAGAAATTGGCACATGG + Intergenic