ID: 949775170

View in Genome Browser
Species Human (GRCh38)
Location 3:7624696-7624718
Sequence CAGGGTATGAAGCATGTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949775162_949775170 22 Left 949775162 3:7624651-7624673 CCGAGTTGTTATGAAAATTTAAT 0: 1
1: 0
2: 4
3: 73
4: 547
Right 949775170 3:7624696-7624718 CAGGGTATGAAGCATGTTAGGGG 0: 1
1: 0
2: 2
3: 8
4: 144
949775161_949775170 28 Left 949775161 3:7624645-7624667 CCATCTCCGAGTTGTTATGAAAA 0: 1
1: 0
2: 0
3: 20
4: 159
Right 949775170 3:7624696-7624718 CAGGGTATGAAGCATGTTAGGGG 0: 1
1: 0
2: 2
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949775170 Original CRISPR CAGGGTATGAAGCATGTTAG GGG Intronic
900854693 1:5171491-5171513 CAGAGTGTGCAGGATGTTAGAGG + Intergenic
910197892 1:84663699-84663721 CACGGTATAATGTATGTTAGAGG + Intronic
910220113 1:84881194-84881216 CAGGTTGTGAGGCATGGTAGGGG + Intronic
913379099 1:118188735-118188757 AAGGGTATGAAGAATGCTGGGGG - Intergenic
914443010 1:147723409-147723431 CAGGGTATGGAGCTTATAAGAGG - Intergenic
916482975 1:165232188-165232210 CAGGGTATGGAGAAGCTTAGGGG + Intronic
919778729 1:201209680-201209702 CAGTGAATGAAGCAGGTTATAGG + Exonic
919778832 1:201210112-201210134 CAGTGAATGAAGCAGGTTATAGG + Exonic
919778904 1:201210436-201210458 CAGTGAATGAAGCAGGTTATAGG + Exonic
922936120 1:229423931-229423953 CAGGATATTAAGCAAGTTAAAGG + Intergenic
923170187 1:231408817-231408839 GAGGGCAAGAAGCAAGTTAGAGG + Intronic
923753606 1:236770131-236770153 TAGAGTATGGAGTATGTTAGGGG + Intergenic
924209523 1:241750011-241750033 GAGCGTATAAAGCATGTCAGAGG - Intronic
1064184323 10:13147507-13147529 CAGGGTATGAAGTATTCTATAGG - Intergenic
1065698242 10:28400378-28400400 CAGGGCAAGAGGCATGTTAATGG - Intergenic
1068330533 10:55560353-55560375 AAAGGTATGAAGGATGTTATTGG - Intronic
1068800956 10:61139262-61139284 CAGAGTATGAATCATTTCAGAGG + Intergenic
1069654639 10:70078782-70078804 AAGGGAATGAATCATATTAGTGG + Intronic
1070731756 10:78833651-78833673 CAGGGAATGAAGAATCTTTGGGG - Intergenic
1073190716 10:101648959-101648981 CAGAGTTTGGAGCATGGTAGAGG - Intronic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1076185557 10:128445526-128445548 CAGAGTTTGAAGCATGTTGTTGG + Intergenic
1078821548 11:14888134-14888156 AAGGGAATGGAGAATGTTAGTGG - Intronic
1084062071 11:66682598-66682620 CCAGGTATGAAGCATGGAAGAGG - Intergenic
1086405769 11:86497888-86497910 CAGGGTGAGGAGCATGTTTGTGG - Intronic
1086949971 11:92882111-92882133 AAGGGTTTGGAGTATGTTAGTGG + Intronic
1088119456 11:106351015-106351037 CAGGGAATAAAGCATGTTAGAGG + Intergenic
1089287259 11:117415622-117415644 CTGGGAATGAAGCAGGGTAGCGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090732081 11:129580611-129580633 CAGGGTAGGAGGCCAGTTAGGGG + Intergenic
1091904550 12:4173785-4173807 CAGGGTACAAAGCCAGTTAGTGG + Intergenic
1093810557 12:23487413-23487435 CAGGATATTATTCATGTTAGAGG + Intergenic
1097866544 12:64563835-64563857 CAGAGTATGTAATATGTTAGAGG - Intergenic
1100096776 12:91048951-91048973 CAGGATATGAAGCCAGTAAGTGG + Intergenic
1100909816 12:99346468-99346490 AGAGGTATGAAGCATGTGAGAGG + Intronic
1101600119 12:106202100-106202122 CAGTGTATTAAGCATGTTCGGGG - Intergenic
1102245477 12:111353146-111353168 CAGGGACTGAAGCATGTTCTGGG + Intergenic
1104328734 12:127824608-127824630 CAGGGGATGAAGCAGGTAGGAGG - Intergenic
1104553403 12:129778370-129778392 CAGGTTATGAAGCCTTTTATAGG - Intronic
1104591828 12:130090118-130090140 CAGGTTATGTAGCAGGTAAGAGG + Intergenic
1105665517 13:22551904-22551926 CAGGGTTTGGAACATGTAAGGGG - Intergenic
1109997143 13:70143292-70143314 CAGGGCAACAAGCATTTTAGAGG - Intergenic
1109998109 13:70156382-70156404 TAGTGTATGAAACATTTTAGTGG - Intergenic
1112312873 13:98335146-98335168 CATGGTAAGTGGCATGTTAGAGG - Intronic
1114611143 14:24041574-24041596 CAGGGCATAAAGCTAGTTAGTGG - Intergenic
1116082347 14:40190808-40190830 CAGGGATTGAGGCATGTGAGGGG - Intergenic
1117616411 14:57537968-57537990 CAGATTATGAAGCCAGTTAGAGG - Intergenic
1120094822 14:80376503-80376525 CAGGCTCTGAAGCATGTGTGAGG - Intronic
1123184779 14:106506334-106506356 CTGGGAATGAAGCCAGTTAGAGG - Intergenic
1123715050 15:23022010-23022032 CAGGGTGTTAAGCAGGTGAGAGG + Exonic
1125087374 15:35746296-35746318 GAGGGTATGAACCATGGTACTGG - Intergenic
1127957139 15:63863301-63863323 CAGGGTTTTAAGCAGGTGAGGGG + Intergenic
1128013365 15:64319792-64319814 CAGGGGGTGAAGCATGATAGCGG - Intronic
1129922671 15:79333284-79333306 CAGGATATGGAGCAAGTTTGGGG + Intronic
1130875211 15:88007864-88007886 TAGGGTATAAGGCACGTTAGGGG - Intronic
1131920770 15:97325975-97325997 GAGGGGATGATGCAAGTTAGTGG + Intergenic
1132545107 16:529374-529396 CAGGGCAAGAAGCAAGTGAGGGG - Intronic
1133466594 16:6033275-6033297 CAGGGAATGATGTATGTTACAGG + Intronic
1133575387 16:7083976-7083998 CAGGGTATCAAGACTGTGAGCGG - Intronic
1134151674 16:11810289-11810311 CAGAGTAGGGAGCAGGTTAGAGG + Intergenic
1134372884 16:13641947-13641969 CAAGGTATGAAGCAGATTAAAGG + Intergenic
1139300451 16:65941253-65941275 CAGGGAAGGAAGCAGGCTAGAGG + Intergenic
1141505857 16:84477946-84477968 CAGGGTGGAAAGCATGTGAGTGG + Exonic
1141998960 16:87653119-87653141 CTGGGTGTGAAGAATGTGAGAGG - Intronic
1142228244 16:88887744-88887766 CAGTGTGTGTAGCATTTTAGTGG - Intronic
1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG + Intronic
1146676523 17:34777113-34777135 CAGTGTATGATGGATGATAGAGG + Intergenic
1147668852 17:42165292-42165314 GAAGGTATGAAGCAGGTAAGGGG + Intronic
1150004376 17:61460826-61460848 CAGGCTATGAAGGCTGATAGTGG - Intronic
1153338784 18:3952737-3952759 AAGTGTATGAAAGATGTTAGAGG + Intronic
1154359775 18:13649839-13649861 CAGGCTGTGGAGCATGTTCGTGG - Exonic
1155339488 18:24799474-24799496 CAGGGTAAGAGGCATGAAAGAGG - Intergenic
1155504474 18:26519636-26519658 CAGGATATCAAGTATGTTATTGG - Intronic
1155520002 18:26657748-26657770 GAGGGTAAAAAGCAAGTTAGAGG - Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1166399444 19:42467471-42467493 CTGGGTATGAATCATGTGAGGGG + Intergenic
927673903 2:25090797-25090819 CAGGGAATAAAGAAAGTTAGGGG + Intronic
928974637 2:37072429-37072451 CAGGCAATGAAGCATCTTTGAGG + Intronic
931087590 2:58850585-58850607 CAGGATATGAAGCAAGTAAGAGG + Intergenic
932538912 2:72630224-72630246 TAGAGGATGATGCATGTTAGAGG - Intronic
933973678 2:87490635-87490657 CAGGGTATGTGGGATTTTAGGGG + Intergenic
936146178 2:109981842-109981864 CAGGGTCTGCAGGATTTTAGGGG + Intergenic
936198513 2:110389637-110389659 CAGGGTCTGCAGGATTTTAGGGG - Intergenic
936320045 2:111459579-111459601 CAGGGTATGTGGGATTTTAGGGG - Intergenic
940020336 2:149149679-149149701 CAGGGAATGAAGCAGGGTCGGGG - Intronic
941209986 2:162625483-162625505 CAGGGGAGGAAGCATTTTAGGGG + Intronic
941920317 2:170843904-170843926 CAGGAAATGAATCATGTTAGTGG + Intronic
944469902 2:200041794-200041816 GAGAGTTTGAAGCATCTTAGTGG - Intergenic
946845795 2:223857869-223857891 CTGGGTATGAAGCAAGTCATTGG - Intronic
947534509 2:230932249-230932271 GAGGGCAGGAAACATGTTAGAGG + Intronic
948471082 2:238179863-238179885 CAGGCTTTGAACCATGTTATAGG - Intronic
1168785719 20:538408-538430 CAGGGTATGAAAGACTTTAGAGG - Intronic
1170056285 20:12208047-12208069 CAGGGTACACAGCATGCTAGAGG - Intergenic
1175307875 20:57989942-57989964 CATGGTATGAAGCAGGTGGGAGG + Intergenic
1182416979 22:30227604-30227626 CAGAGTATGCAGCATGTCTGTGG - Intergenic
1182517504 22:30867370-30867392 CAGGGTTTGAAGAAAGTTGGGGG - Intronic
1183051519 22:35265699-35265721 CTGGGAATTAAGCATGTTTGGGG + Intronic
949594916 3:5533001-5533023 CAGGGTCTGGGGCTTGTTAGAGG + Intergenic
949775170 3:7624696-7624718 CAGGGTATGAAGCATGTTAGGGG + Intronic
952911772 3:38195819-38195841 CAGGCTATGAAGCCTGACAGGGG + Intronic
955543277 3:60000595-60000617 GAGGGTAGGAAGAATGCTAGAGG + Intronic
959392446 3:105792956-105792978 CAGAGGATAAAGCATCTTAGTGG - Intronic
963110229 3:141682402-141682424 TGGGGTATCAAGCATGTTAAGGG + Intergenic
971362625 4:25951584-25951606 CAGGGTCTGAAGCAGGGGAGGGG + Intergenic
973156181 4:46955853-46955875 CAGGCTATTAATCTTGTTAGTGG - Intronic
975107709 4:70587324-70587346 CAGCAAATGAAGCAAGTTAGAGG + Intergenic
979712065 4:123791379-123791401 CAGGGTATGTAGAATGGTATTGG + Intergenic
979723796 4:123935624-123935646 CATGGTATGAAGTATGTGAGGGG + Intergenic
983519655 4:168694456-168694478 CAGGGAATGAAGGAGGTGAGGGG - Intronic
986620332 5:9666375-9666397 CAGGGGATGTGGCATTTTAGGGG - Intronic
986683966 5:10259695-10259717 CAGGGATTGAAGCATGCTGGCGG + Intronic
988334415 5:29887434-29887456 CAGGGTAAGAAGAATGTAACAGG + Intergenic
992397084 5:76378227-76378249 CAGGGTGTGAAGCAGGAGAGTGG + Intergenic
992921524 5:81527487-81527509 CAGGGTATCAATCAAGTTTGAGG + Intronic
996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG + Intergenic
999231901 5:150066675-150066697 CAGGGTGGGAAGGATGTTGGGGG - Intronic
1001652486 5:173325832-173325854 CAGAGCATGAAGAATGTTTGGGG - Intronic
1004160523 6:13208891-13208913 CAGGGTATGCAGCATGATCTCGG + Intronic
1004185006 6:13414172-13414194 CAGGGTACCTAGCTTGTTAGTGG - Intronic
1006696368 6:35933771-35933793 CAGGGGATGTAGCAGGTTAAGGG + Intergenic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1011346550 6:86375843-86375865 CATGGTTTGAAGCATGTTTTAGG + Intergenic
1012353292 6:98280258-98280280 CAGGTTTTGAAGCCTGATAGAGG + Intergenic
1013043140 6:106456849-106456871 CAGGGGATGGAGCAGGTTTGGGG - Intergenic
1017076025 6:150619566-150619588 CTTGGTATGAAGCATCTCAGTGG - Intronic
1022349181 7:29551032-29551054 TAGGTTAAGAAGCATGGTAGGGG + Intergenic
1022534478 7:31087278-31087300 GAGGGGATGAAGCATGTTGAGGG + Intronic
1029008375 7:97233089-97233111 CTGGCTAAGAAGCCTGTTAGAGG + Intergenic
1030187395 7:106777376-106777398 CTGGAGATGGAGCATGTTAGGGG + Intergenic
1031390564 7:121208765-121208787 CAGTGTATGACCAATGTTAGGGG + Intronic
1031876708 7:127150112-127150134 CAAGGTATAAAACATGTTAAGGG - Intronic
1034330494 7:150278199-150278221 CAGGGAATGCAGCATGGGAGGGG - Intronic
1034667548 7:152831649-152831671 CAGGGAATGCAGCATGGGAGGGG + Intronic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1042787530 8:72566278-72566300 CAGAGTTTAAAGCATGTGAGTGG + Intronic
1042953198 8:74221841-74221863 CAGTGTCTGAAGAATGTCAGAGG - Intergenic
1043618805 8:82161973-82161995 AAGGCTATGAAGAATGTTAAAGG - Intergenic
1043945379 8:86245035-86245057 CTGGGTAGGAAGCATGAAAGGGG + Intronic
1045116199 8:98983500-98983522 CAGAGTCTCAAGCATGTTAGGGG + Intergenic
1048434509 8:134403501-134403523 CAGGGTGTGTAGGATGTTGGAGG - Intergenic
1050654684 9:7814085-7814107 CAGTGTGTAAAGCATGTTATAGG - Intronic
1052655720 9:31357215-31357237 CAAGGTATAAGGCATGTTAAGGG + Intergenic
1056035116 9:82595993-82596015 CAGGGTATGTCTAATGTTAGAGG + Intergenic
1058041182 9:100303613-100303635 CACGGTAAGAAGCATGGTACCGG - Exonic
1186281882 X:8002058-8002080 CAGGATATGAAGCATCAGAGTGG - Intergenic
1186475000 X:9850403-9850425 CAGGTTATGAAGTGAGTTAGCGG + Intronic
1187243913 X:17537436-17537458 CAGGCTAGGAAGCATATTACTGG - Intronic
1188484856 X:30671389-30671411 CAGGTTATGTAGCTTTTTAGTGG + Intronic
1194796506 X:98218062-98218084 CAGGTTATGAAAAATCTTAGAGG + Intergenic
1195443333 X:104921935-104921957 CAGGGTAAGAAGGATGCCAGGGG - Intronic
1195964081 X:110414360-110414382 CATGGTATGGAGCATGGAAGTGG - Intronic
1200942271 Y:8797372-8797394 CTGGATATGAGGCAAGTTAGTGG - Intergenic
1200986263 Y:9305482-9305504 GAGGGGATAAAGCATGTCAGGGG - Intergenic
1202124314 Y:21555420-21555442 GAGGGGATAAAGCATGTCAGGGG + Intergenic
1202154694 Y:21873960-21873982 GAGGGGATAAAGCATGTCAGGGG - Intergenic