ID: 949779404

View in Genome Browser
Species Human (GRCh38)
Location 3:7669249-7669271
Sequence TGGGCATAATTTAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949779401_949779404 -1 Left 949779401 3:7669227-7669249 CCTATAAGCGAGTAAAACAAGAT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG 0: 1
1: 0
2: 3
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949779404 Original CRISPR TGGGCATAATTTAGACTTGA AGG Intronic