ID: 949779404

View in Genome Browser
Species Human (GRCh38)
Location 3:7669249-7669271
Sequence TGGGCATAATTTAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949779401_949779404 -1 Left 949779401 3:7669227-7669249 CCTATAAGCGAGTAAAACAAGAT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG 0: 1
1: 0
2: 3
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949779404 Original CRISPR TGGGCATAATTTAGACTTGA AGG Intronic
901728519 1:11261512-11261534 TGGGCATAATTGAGGAATGAGGG - Intronic
904957525 1:34297425-34297447 TGGTAATAATTTAGAGTTGAAGG - Intergenic
905812264 1:40921384-40921406 TGGGCATAATTTGAACCTCATGG - Intergenic
907870469 1:58438324-58438346 TGGGCCTAATCAAGTCTTGAGGG + Intronic
913421405 1:118673778-118673800 TGGGCTTCATTTAGTCTTGCTGG + Intergenic
915635314 1:157182236-157182258 TGGGCATTCATTAGACTTGCTGG - Intergenic
916185648 1:162129968-162129990 TGGGTTTAATTTATACTTGTTGG + Intronic
916653791 1:166854789-166854811 AGTGCATAATTAAGACTTGCGGG - Intronic
918125751 1:181581975-181581997 TGGATATAATTTACACTGGAGGG + Intronic
918610631 1:186486604-186486626 TATGTATAATTTAGATTTGATGG - Intergenic
922589595 1:226764642-226764664 TGGGTTTAATTTGGACTTGCTGG - Intergenic
923768821 1:236919107-236919129 TTAGCTTAATTTAGTCTTGATGG + Intergenic
1064558881 10:16575958-16575980 TGGACATAATTTAATCATGAAGG + Intergenic
1066248447 10:33608708-33608730 TGGGCATTTTGTAGACATGAAGG + Intergenic
1069530863 10:69218404-69218426 TGGGCTTAAGTGAGACCTGATGG + Intergenic
1070203733 10:74234137-74234159 TGGGAATGATATAGACTTGGGGG + Intronic
1070578714 10:77702211-77702233 TAGCCATAATGTAGCCTTGAGGG - Intergenic
1070685451 10:78477155-78477177 TGCACATACTTTAGTCTTGAGGG + Intergenic
1071196861 10:83171291-83171313 TGGGCAAACTTTCCACTTGATGG + Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074458889 10:113619216-113619238 TTTGCATAATTTAGACTTCAGGG - Intronic
1076304376 10:129454026-129454048 TGAGAATGATTTAGACTTTATGG + Intergenic
1077510532 11:2958838-2958860 TGTGCATCATGCAGACTTGACGG - Intronic
1078710691 11:13787992-13788014 TGGGCATAATTTAAATGTCAGGG - Intergenic
1081045193 11:38265201-38265223 TGAGCATAATCTAGAAATGAAGG + Intergenic
1085135828 11:74087203-74087225 TAGGCATAATATATACTTCATGG - Intronic
1088331565 11:108659439-108659461 TGTGCATTCTTTAAACTTGATGG + Intergenic
1088701182 11:112413484-112413506 TAGGCAGAATTTAGATTTCATGG - Intergenic
1092642526 12:10531329-10531351 TGGTCATAATTTGGAGATGAAGG + Intergenic
1096013173 12:48240688-48240710 AGGGCAAAATCTAGAATTGATGG - Intergenic
1097132614 12:56823828-56823850 TTGGCAAAATTAAAACTTGATGG + Intergenic
1107121317 13:36799266-36799288 TGGGCATTATTTAAAAATGAAGG - Intergenic
1107537141 13:41346598-41346620 TTGGCATACTTTAGACTGGCGGG + Intronic
1110084985 13:71366263-71366285 TGGTAATAATTTATACTTGTAGG - Intergenic
1110753204 13:79139983-79140005 GGGGCTTAAATTAGACTTCAGGG + Intergenic
1110988941 13:82012320-82012342 TGTGGATAATTTACACTTGAGGG + Intergenic
1112837759 13:103536628-103536650 GGGGCAGAAATTAGACTAGAGGG + Intergenic
1113699050 13:112369754-112369776 TGGGCATTTTGTAGACATGATGG - Intergenic
1114132018 14:19802019-19802041 TGGGCATAGTTGAGATTGGATGG - Intronic
1116010100 14:39341374-39341396 TGGGAATAATTCAGGCTAGAAGG + Intronic
1118198121 14:63647240-63647262 TGTGTATAATTTGGACTTCATGG - Intergenic
1119909666 14:78338095-78338117 TGGGAATAATTTAGTCTTTGAGG - Intronic
1120121749 14:80688870-80688892 TTGGTGTAATTCAGACTTGATGG - Intronic
1120218265 14:81704222-81704244 TGGGCCTACTTTAGATTGGATGG - Intergenic
1120427486 14:84366650-84366672 TGGGGTTAATTTAAACTAGAAGG + Intergenic
1120721727 14:87896596-87896618 TGGACATATCTTAGACCTGAGGG + Intronic
1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG + Intronic
1129248134 15:74292468-74292490 TAGGGAGAATTTAGACATGATGG + Intronic
1130634211 15:85601057-85601079 TGAGCAAAATTTATCCTTGATGG + Intronic
1138147209 16:54623426-54623448 TGGTCATAAATTAAACTTGGGGG - Intergenic
1141525349 16:84607473-84607495 TGGGGATAATTTCTACTTGTGGG + Intronic
1141979044 16:87538297-87538319 TGGAAACAATTTAGACTTGGGGG - Intergenic
1144069081 17:11651176-11651198 TGTGGCTAATTTAGAGTTGATGG + Exonic
1147353638 17:39872875-39872897 TTTGAATAATTTATACTTGATGG - Intronic
1148347287 17:46911996-46912018 TTGGCCTAGTGTAGACTTGAGGG - Intergenic
1151134011 17:71927686-71927708 TCGGCATAATTAAAACTGGAGGG - Intergenic
1153175249 18:2364578-2364600 TGGGCATAGCTTAGCCTTCAAGG - Intergenic
1153234515 18:2972881-2972903 TGGGCATATTTTAGCCTTGATGG - Intronic
1155051898 18:22155822-22155844 TGGCTAGAATTTAGACGTGATGG - Intergenic
1158870010 18:61677013-61677035 TTTGCATATTTTACACTTGATGG - Intergenic
1159991040 18:74907795-74907817 TGTGTATATTTTAAACTTGAAGG + Intronic
1166073395 19:40399296-40399318 TGGGAATAATGTAGACGAGAAGG - Intronic
928716773 2:34070671-34070693 TGAGCATATTTTATACTTGGTGG + Intergenic
929109156 2:38391923-38391945 TGGACACAATCTAGTCTTGAGGG + Intergenic
929883011 2:45853630-45853652 GGGGCATAATTTTTACTTGCTGG + Intronic
932772569 2:74508610-74508632 TGGGCACAATTTAGACTTGGGGG + Intergenic
936968891 2:118155141-118155163 TGGGCAAAATTTGGAGTTCAGGG + Intergenic
939266620 2:139882152-139882174 TAGGGATATTGTAGACTTGAAGG + Intergenic
939779813 2:146431925-146431947 TGGGAAATATTTAGCCTTGAAGG + Intergenic
940182306 2:150948603-150948625 GGGGTATAATTTATACTTGCTGG + Intergenic
943914597 2:193613834-193613856 TGAGCAAAATTTTCACTTGATGG - Intergenic
944115007 2:196176546-196176568 TGGGCAGAACTGGGACTTGAAGG - Intergenic
944943680 2:204658228-204658250 TGGGCAATAGTTTGACTTGAAGG - Intronic
945049688 2:205811383-205811405 TGGGGATAATTTAGAAGTAAGGG + Intergenic
945250149 2:207759106-207759128 TAGGCAGAAATTAGACTTTAAGG - Intronic
946113889 2:217445107-217445129 TGGGCTGAATTAAGACCTGAAGG + Intronic
1170842165 20:19932867-19932889 TGGGGAAGAATTAGACTTGAGGG - Intronic
1173905013 20:46620802-46620824 TGGGCAAACTTTCCACTTGATGG + Intronic
1175577885 20:60076144-60076166 TGGGCACTATTTATACTTCAAGG - Intergenic
1175604692 20:60303137-60303159 AGGGAATAATATAGGCTTGATGG - Intergenic
1179143202 21:38745484-38745506 TAGGTATAATGTAGACTTAATGG + Intergenic
1179264485 21:39790933-39790955 TGGGCATAATTTAAAATATATGG + Intronic
949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG + Intronic
950892710 3:16418876-16418898 AGGGCAGGATCTAGACTTGAGGG - Intronic
953275004 3:41486449-41486471 TGGCCATCATTTACATTTGACGG + Intronic
954192689 3:48975490-48975512 TGGACATATTTTCTACTTGAAGG - Intronic
955539315 3:59957204-59957226 AGGGCATAATTTTAACTTGATGG - Intronic
960288317 3:115854682-115854704 TGGGCAGGATTTAGGATTGAAGG + Intronic
961205216 3:125076284-125076306 TGGCCATAATTTAGGCTTTCAGG - Intergenic
963223569 3:142837592-142837614 TTGGCATAATGGTGACTTGAAGG + Intronic
963268277 3:143260593-143260615 AGGGCATAATTTAGTCCTTAGGG - Intergenic
969489859 4:7492985-7493007 GGAGCATCATTTAGACTTTATGG - Intronic
971099228 4:23444689-23444711 TGGGAAAAATTTAGATTTGATGG + Intergenic
971955948 4:33418529-33418551 AAGGCATAATTTAGCTTTGAGGG + Intergenic
972867349 4:43249595-43249617 TAGGCATAATTTATTCTTTATGG + Intergenic
974058709 4:57010765-57010787 TGTGAAGAATTTAGCCTTGATGG + Exonic
974204527 4:58683698-58683720 TGAGCAAACTTTATACTTGATGG + Intergenic
975506709 4:75146190-75146212 TGAGAATAAATTTGACTTGATGG + Intergenic
979845203 4:125500375-125500397 TTGGAATAATTGAGACTTGAGGG + Intergenic
979878413 4:125923412-125923434 TGGGCATAATTCTGATATGAGGG - Intergenic
982327473 4:154143593-154143615 TGTGCAGAATTTGAACTTGATGG - Intergenic
983395260 4:167185962-167185984 TGGGCATATGTTATATTTGAGGG - Intronic
985321364 4:188715394-188715416 TGGACAAAATTCAGACTTCAGGG + Intergenic
987023974 5:13905073-13905095 TGGTCATAATTTAGCATTAAAGG + Intronic
988769490 5:34417597-34417619 TCAGCATAATTTAGACTCTAAGG + Intergenic
991457521 5:66820503-66820525 TGTGCATCATTTAGACATGAAGG + Intronic
991745889 5:69740662-69740684 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991751814 5:69814571-69814593 TGGGCCTACTTTAGAGTGGAGGG + Intergenic
991797490 5:70320620-70320642 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991825267 5:70615976-70615998 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
991831104 5:70689472-70689494 TGGGCCTACTTTAGAGTGGAGGG + Intergenic
991889832 5:71319941-71319963 TGGGCCTACTTTAGAGTGGAGGG - Intergenic
993951951 5:94186976-94186998 TGGGAATAGTTCAGACTTGATGG + Intronic
995242457 5:109900550-109900572 TGGGCATTTTGTAGACATGATGG + Intergenic
1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG + Intergenic
1010443699 6:75927867-75927889 GGGGCATAACATGGACTTGAGGG - Intronic
1010694102 6:78948860-78948882 TGATCATAATTTAAACTTGATGG - Intronic
1011046423 6:83088199-83088221 ATGGCATAATTAAGACTAGAAGG + Intronic
1011584070 6:88905219-88905241 TGTGAAGAATTTAGTCTTGAAGG + Intronic
1014070170 6:117172518-117172540 TGGGCAAACTTTCTACTTGATGG + Intergenic
1018177788 6:161192862-161192884 TGGGAAGAAGTTAGACTTTAGGG + Intronic
1023599406 7:41866253-41866275 GAGGCATAATTTATAGTTGAAGG - Intergenic
1024818005 7:53293911-53293933 TGGGCATTATTTTGACTTGAGGG - Intergenic
1026136984 7:67672172-67672194 TTGTAATAATTTAGAATTGATGG - Intergenic
1029001437 7:97159104-97159126 TGTGAATAATACAGACTTGAAGG - Intronic
1029088843 7:98032462-98032484 TGGGCTTGATTTAGGCTTGGGGG - Intergenic
1030317136 7:108127398-108127420 TGAGAAGAATTTAGATTTGAAGG - Intronic
1030673621 7:112363548-112363570 TGGCAATAATTTACACTTGTGGG + Intergenic
1030869383 7:114736356-114736378 TGGTTATAATTTTGAATTGAGGG - Intergenic
1031453595 7:121952291-121952313 TTAGCATAATAAAGACTTGAAGG + Intronic
1033379425 7:140799426-140799448 AGGCCAGAATTTAGACTTAAAGG - Intronic
1036439112 8:8764611-8764633 TGGTGATAATTTAGATTTGTAGG + Intergenic
1037285756 8:17297731-17297753 TGGGGATATTTTAGTCTTGTTGG + Exonic
1040456557 8:47604161-47604183 TGGACATAATTTAGTTTAGAGGG + Intronic
1042110599 8:65377414-65377436 TAGACAAAATTTTGACTTGAAGG - Intergenic
1043414831 8:80036174-80036196 TGGGCAGAAAAGAGACTTGAGGG + Intronic
1044889650 8:96819961-96819983 TGGGCAAACTTTCCACTTGATGG - Intronic
1045137916 8:99243019-99243041 TAGTCAAAATTTAGACTTTAAGG - Intronic
1048387847 8:133929773-133929795 TGGGCATTTTGTAGACATGATGG + Intergenic
1050625744 9:7502206-7502228 TAGGCATAACATAGGCTTGATGG + Intergenic
1055281636 9:74681102-74681124 TGGGGATTATTTAAACATGAAGG + Intronic
1059121822 9:111646644-111646666 TGGGCATAATTCAGTTTTGTAGG + Intronic
1059336883 9:113574696-113574718 TGGGCAGGAAGTAGACTTGAGGG + Intronic
1059427404 9:114229768-114229790 TGGGCAGAAGTGAGATTTGAGGG + Intronic
1185614973 X:1415270-1415292 TGGCCTTAGGTTAGACTTGAAGG - Intronic
1186584268 X:10855118-10855140 TGGCCAGAATTTAAACTGGATGG - Intergenic
1187000671 X:15173631-15173653 TTGGCATCGTTTAGACTTGTAGG - Intergenic
1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG + Intergenic
1188061939 X:25611645-25611667 TGGTCATATTTTAAACTGGAAGG + Intergenic
1188129244 X:26410649-26410671 TGGGCATTATTTAGACAAGCTGG + Intergenic
1188163030 X:26825811-26825833 TGGACATAATTCAGACTGAAGGG - Intergenic
1188523087 X:31060038-31060060 TGGGCATTTTTTAAACTTCAGGG + Intergenic
1190752082 X:53371205-53371227 GGGGCAAAAAGTAGACTTGATGG + Intergenic
1192618855 X:72656145-72656167 TGGACATACTTTATTCTTGATGG - Exonic
1193806137 X:85997207-85997229 GGGGCATCATTTAGATTTGGTGG - Intronic
1194195798 X:90890765-90890787 TGGGCATATGTTATGCTTGAGGG - Intergenic
1196236360 X:113285380-113285402 TGGGGATACTTTAGACCTTAGGG + Intergenic
1197682133 X:129396614-129396636 TGGACAAAATATAGACTTCAAGG + Intergenic
1198473295 X:136970590-136970612 TGGGCATTTTGTAGACATGATGG - Intergenic
1199228528 X:145408494-145408516 TGGAGATAATTCAGTCTTGAGGG + Intergenic
1200541652 Y:4464959-4464981 TGGGCATATGTTATGCTTGAGGG - Intergenic
1200838936 Y:7760758-7760780 AGGGCAGGATCTAGACTTGAGGG - Intergenic
1201382631 Y:13400278-13400300 TTGGCCTAATTCAGACTGGATGG + Intronic