ID: 949782247

View in Genome Browser
Species Human (GRCh38)
Location 3:7702775-7702797
Sequence TTGAATAATTAGGAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949782244_949782247 28 Left 949782244 3:7702724-7702746 CCTAATTACAGGCTACAGATTTT 0: 1
1: 0
2: 0
3: 17
4: 181
Right 949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG 0: 1
1: 0
2: 3
3: 50
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949782247 Original CRISPR TTGAATAATTAGGAAGAGGA TGG Intronic
902452587 1:16506796-16506818 TTGAATAATTAGAAATGGAAAGG + Intergenic
902472649 1:16659457-16659479 TTGAATAATTAGAAATGGGAAGG + Intergenic
902486155 1:16747986-16748008 TTGAATAATTAGAAATGGGAAGG - Intronic
903017691 1:20371932-20371954 TTTGATAATGAGGAAGAGGAGGG + Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903311566 1:22461999-22462021 TTGAACAAGTAGGAAGTGGCAGG + Intronic
903792126 1:25900968-25900990 TTGGATATTTAGGAAGGGGATGG + Intronic
904164987 1:28548542-28548564 ATAAATAATTAGCAAGAGGTGGG + Intergenic
904223043 1:28989006-28989028 TGGAATTATTAGGAACAGGACGG + Intronic
904849457 1:33446415-33446437 TTGAGTCATTTGGAAGAGCAGGG + Intergenic
905585244 1:39112062-39112084 TTGAATAATCAGGAAGGGAGAGG - Intronic
905601792 1:39258573-39258595 TTGCCTTCTTAGGAAGAGGAAGG - Intronic
905737157 1:40337463-40337485 TTGAATAAAAAGGCAGAGGAAGG + Intergenic
905961340 1:42045023-42045045 TTGAACCAATAGGAAGAGGAGGG - Intergenic
906055416 1:42912370-42912392 TGGAATAAAAAGGTAGAGGAGGG - Intergenic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
906663535 1:47599823-47599845 TTGATTAATTCAAAAGAGGATGG + Intergenic
908643583 1:66252129-66252151 TTGAAGGATAAGGAAGAGGGAGG + Intronic
908695233 1:66832352-66832374 TTGCATAATGAGGTAGATGATGG + Intronic
909156854 1:72089082-72089104 TTGAATCATTAGGCAGAGGTGGG + Intronic
909164802 1:72206166-72206188 ATTAATTATTTGGAAGAGGAAGG + Intronic
909359996 1:74749061-74749083 TTGCCTACTTAGGATGAGGAGGG - Intronic
909485733 1:76171543-76171565 TAGACTAATAAGGAAGAAGAGGG + Intronic
910674900 1:89806920-89806942 TAGCATAACTAGTAAGAGGAGGG - Intronic
910693233 1:89985480-89985502 TTTAAACATTGGGAAGAGGAGGG + Intergenic
911152976 1:94612783-94612805 TGAAAGAATTAGGAAGAAGAGGG + Intergenic
911383684 1:97147654-97147676 TGGGATATTTAGGAAAAGGAAGG - Intronic
911839645 1:102664370-102664392 TTCAATAAATAGGAAAATGATGG - Intergenic
913230696 1:116738441-116738463 AGAAATAACTAGGAAGAGGAGGG + Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913564391 1:120057667-120057689 CTGAATAAGTAAGAAGTGGATGG - Intronic
913633737 1:120735897-120735919 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914214499 1:145612934-145612956 TTGAATAGTGAGGTAGAGGCAGG - Intronic
914284978 1:146217016-146217038 CTGAATAAGTAAGAAGTGGATGG - Intronic
914546009 1:148667755-148667777 CTGAATAAGTAAGAAGTGGATGG - Intronic
914620555 1:149402911-149402933 CTGAATAAGTAAGAAGTGGATGG + Intergenic
914955142 1:152155248-152155270 TTGAACAATCAGGAAGATCAGGG - Exonic
915165200 1:153944474-153944496 TGGAAGGACTAGGAAGAGGAGGG - Intronic
915577945 1:156793441-156793463 TTGCTTTTTTAGGAAGAGGAAGG + Intronic
916064039 1:161121661-161121683 TTCTATAATTTGGAAGAGGGTGG + Exonic
916102008 1:161400684-161400706 TTGGAAAATTAAGAAGAGGCCGG + Intergenic
916127409 1:161583571-161583593 TTGGATAACTAGGAAAAGGGTGG - Intronic
916137327 1:161665375-161665397 TTGGATAACTAGGAAAAGGGTGG - Intronic
916508452 1:165449533-165449555 TTGAATAAGTGGAAAGAGCATGG + Intergenic
916590667 1:166186922-166186944 TAGAACAATAAGGTAGAGGAAGG + Intergenic
917118033 1:171622093-171622115 GTGAATTATCAGGAAGAGGTGGG + Intergenic
918251239 1:182705326-182705348 TAGAATAAAAAGGCAGAGGAAGG - Intergenic
918281855 1:183014469-183014491 TTGAACAAATTGGAAAAGGAGGG - Intergenic
919037843 1:192338951-192338973 TTGCATAACTAGAAAGGGGAAGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
921410291 1:214829035-214829057 GTGAATAAATAGGAAGTGAAGGG - Intergenic
922718298 1:227887948-227887970 TTTATTAAAAAGGAAGAGGAGGG - Intergenic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
924668455 1:246098018-246098040 TTAAATAATTAGACACAGGAAGG - Intronic
1063333763 10:5188757-5188779 TTGAGTAATTTGGAACAGGATGG + Intergenic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064898760 10:20270471-20270493 TTGAATATGTAGGATGAAGAAGG + Intronic
1065208966 10:23384214-23384236 TTGAACAATTTGGAAGAGTTGGG - Intergenic
1065476154 10:26140056-26140078 TTGCTGAATTAGGAAGATGAAGG + Intronic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1068643478 10:59438082-59438104 CTGAATGAATAGGAAGAGAAAGG - Intergenic
1068735725 10:60411221-60411243 TCACAGAATTAGGAAGAGGAGGG + Intronic
1069264533 10:66441962-66441984 GTGAATAATTATGGAAAGGATGG - Intronic
1069579949 10:69559152-69559174 TTGAATACTTAGCAAGTGGTAGG - Intergenic
1070445603 10:76498041-76498063 TCCAATATTTGGGAAGAGGATGG - Intronic
1070822713 10:79371339-79371361 CTGAATAATTAGGCTGAGCATGG - Intergenic
1071688359 10:87787321-87787343 TAAAAGATTTAGGAAGAGGATGG + Intronic
1071996259 10:91152657-91152679 TTGAATAAATTGGGAGAGGCTGG + Intergenic
1072808418 10:98440816-98440838 TTCAATAAAGAGGAAGAGAAAGG + Intronic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074206598 10:111288115-111288137 TTTCATAATTAGGAAAAGGAAGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1075547093 10:123363182-123363204 TTGAGGAATTAGGCAAAGGATGG + Intergenic
1075861414 10:125679837-125679859 TAAAATAATAAGGCAGAGGAGGG - Intronic
1078159127 11:8825527-8825549 TAGAATAAATGGGAAGAGAAAGG - Intronic
1079335291 11:19565336-19565358 TTGAATAATTTGAAAGATTAGGG - Intronic
1079489552 11:20972356-20972378 ATGAGTAGTTAGGAAGGGGAGGG + Intronic
1079524636 11:21370522-21370544 TTGAGTAACTAGGAAGGGTAGGG - Intronic
1079655726 11:22984552-22984574 TTGAATAATTTGGAAGAGATTGG - Intergenic
1079878322 11:25889231-25889253 TTAAATTTTTGGGAAGAGGATGG - Intergenic
1080110094 11:28557051-28557073 ATGCAGAATTGGGAAGAGGAGGG - Intergenic
1080566762 11:33516656-33516678 CTGAATAATTAGGAAGAAAAAGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1081126116 11:39324640-39324662 ATGAAGAATTAGGAAGAGTTGGG - Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1082181038 11:49119974-49119996 TTGAACAAATGGGAAGAGGAAGG + Intergenic
1083133385 11:60647711-60647733 CTGAACCATTAGGAAGAGAAGGG - Intergenic
1083136518 11:60682980-60683002 TTGAAAAACTAGGAATAGAATGG + Intergenic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1085474089 11:76778639-76778661 TTGAATAATAAGCAAGAGACGGG + Intergenic
1085653967 11:78295482-78295504 TTGAATGATTGGAATGAGGAAGG - Intronic
1085981119 11:81727343-81727365 TTCAATAATTAGGAATAGAAGGG - Intergenic
1086264621 11:84983026-84983048 TTGAATAAAAAGGATGAGGGTGG - Intronic
1086684451 11:89714899-89714921 TTGAACAAATGGGAAGAGGAAGG - Intronic
1087118518 11:94548215-94548237 TGGAATAATTAGCATGAGGAAGG + Exonic
1087707854 11:101515134-101515156 TTGAATAATTATGATTAAGAAGG - Intronic
1088921714 11:114264152-114264174 GTGAATAATTAGGAAGAGAGGGG - Intronic
1089713321 11:120333380-120333402 CTGAATAATTGGTAAGGGGAAGG + Intronic
1089794825 11:120971846-120971868 TTGAATAGGTAGGATGAGGTTGG + Intronic
1091445073 12:540385-540407 TTAAATAATTAGGATGTGCAGGG + Intronic
1092600921 12:10063444-10063466 TTGGTTAATTAAAAAGAGGAGGG + Intronic
1092609218 12:10154039-10154061 TAGAGTTATTCGGAAGAGGACGG + Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1093359995 12:18212866-18212888 TTCAAAAAATTGGAAGAGGAGGG + Intronic
1093463463 12:19427076-19427098 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1094170831 12:27489981-27490003 TGGAATAATATGCAAGAGGAAGG + Intronic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094273946 12:28647119-28647141 ATTAATAAATAGCAAGAGGAAGG - Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095732455 12:45521002-45521024 TGGAACAAAAAGGAAGAGGAAGG - Intergenic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1096494542 12:52032274-52032296 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1097547081 12:61016961-61016983 TTGAAAGACTAGGAAAAGGAAGG - Intergenic
1098065815 12:66614906-66614928 TAGAATAATTGAGAAGAGGCTGG - Intronic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1099784497 12:87243425-87243447 TTGAATAAAGAGGAAAAGTAAGG + Intergenic
1099881151 12:88468014-88468036 TTGAAAAATTATGAAAAGGAAGG - Intergenic
1100112796 12:91265800-91265822 TTGAAGAATTTTGAAGAAGAGGG + Intergenic
1100220377 12:92498494-92498516 TTTAAAAATTAGGAAAAAGAAGG + Intergenic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101132179 12:101700200-101700222 TTGAACACTTAGAAAGAGCAGGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1103102099 12:118186673-118186695 TTGAAGAATTAGGAAAAGGAAGG - Intronic
1104338020 12:127918819-127918841 TGGAATATATAGGAAGAGCAAGG - Intergenic
1105754788 13:23454244-23454266 TAGAATAATAAGGCTGAGGAAGG - Intergenic
1105897991 13:24733662-24733684 TAGAATAATTAGGCAGGGCACGG - Intergenic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106653701 13:31719535-31719557 TGGAATAAAAAGGTAGAGGAAGG - Intergenic
1107497761 13:40945280-40945302 TTGAATGATTAGGAAGATGTTGG - Intronic
1108730747 13:53232966-53232988 TTGAGTAATTGGGAAGATGATGG - Intergenic
1108853318 13:54762562-54762584 AAGAAAAATGAGGAAGAGGAGGG + Intergenic
1109103776 13:58222310-58222332 TTGATTAGTTAGCAGGAGGAAGG + Intergenic
1109352524 13:61202884-61202906 TTGATTAAATGTGAAGAGGAGGG + Intergenic
1109713840 13:66194511-66194533 TGGAATAAATTGGAAGAAGAGGG + Intergenic
1109877737 13:68428116-68428138 TTTATTAATGAGGAAGAAGAAGG + Intergenic
1110550564 13:76807032-76807054 TTGCATAACTTGGAAGATGATGG + Intergenic
1114553471 14:23547765-23547787 TTGAATTAGTAGGGAGAGGCTGG - Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1117610002 14:57473438-57473460 TTGAACAATTAGGCAGACAATGG - Intronic
1118227224 14:63913304-63913326 TTGAATGGTTAGGAAGAGAAAGG + Intronic
1118561462 14:67087860-67087882 TTAAAAAAAGAGGAAGAGGAAGG - Intronic
1118798417 14:69166801-69166823 TGGAAGAATTTGGAAGGGGAGGG + Intergenic
1118912548 14:70073790-70073812 TCTAATAATTAGGAAGAGAGAGG + Intronic
1120051604 14:79873512-79873534 TGGAAGAATGAGGAAGAGAAAGG - Intergenic
1120313800 14:82865978-82866000 ATGAATAATTAGGAAACAGAGGG - Intergenic
1121233034 14:92372310-92372332 CTGAATAAATGGGAACAGGAGGG + Intronic
1121927145 14:97938126-97938148 TTGAATAACTAGAAGTAGGAAGG + Intronic
1124194518 15:27609699-27609721 TTGAATAATTAGTAAGAACTGGG - Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125617630 15:41029777-41029799 CTGAATAATTAGGAGGAAAAAGG + Intronic
1125938625 15:43659060-43659082 ATGCATAATCAGGAAGGGGATGG + Intronic
1126529149 15:49692425-49692447 GTGAATAGTTAGGTAGAGAATGG - Intergenic
1126842352 15:52729584-52729606 ATGAATAGTTAGGAAGCTGAAGG + Intergenic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127688173 15:61368802-61368824 GTGAATCAATAGGAAGAGAAAGG + Intergenic
1128101368 15:65003047-65003069 TTGAGTAGTTAGGAAGAAGATGG - Exonic
1128611189 15:69074705-69074727 TTGAAGCATTAGCAAGAGGGTGG - Intergenic
1128615711 15:69107392-69107414 TTGACTAGTAAGGAAGAGGGAGG + Intergenic
1129177704 15:73852095-73852117 TTGAATAATGGGGAAGAGTCAGG - Intergenic
1129511842 15:76129764-76129786 GTGAAAAATGAGGTAGAGGAAGG + Intronic
1129553194 15:76475617-76475639 TTTAATTTTTAGGAAGAGCAGGG + Intronic
1130123902 15:81076125-81076147 TTGCAAAATTAGGAAGGAGAAGG - Intronic
1130245065 15:82239434-82239456 TTGTAGAAATAGGAAGAGGTAGG - Intronic
1130765552 15:86867079-86867101 GTGAGTAATGAGGAAGAAGAGGG + Intronic
1132134295 15:99319346-99319368 TTGAAGAATGAGGAAGATAAAGG + Intronic
1134141976 16:11728130-11728152 TTGAATAATTAGGAAAGTTAAGG - Intronic
1134239757 16:12496847-12496869 TTGAATAATTAAGTAGACAAGGG + Intronic
1134308986 16:13059003-13059025 TAGAATAATTAGGAATTGAATGG + Intronic
1134458249 16:14410382-14410404 TTTAAGCATTAGGAAGAGGCCGG - Intergenic
1134776672 16:16859372-16859394 TTGACCAATTAGGAGGAGAAAGG + Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136018433 16:27423480-27423502 TTGAATAGTGTGGAAAAGGAGGG - Intronic
1137293736 16:47070242-47070264 TTTTAAAATTGGGAAGAGGATGG + Intergenic
1137451235 16:48576713-48576735 TTGAAAAAGTAGGAAGGAGAAGG - Intronic
1139084958 16:63573491-63573513 TTGCATAGTTAGGAATAGGATGG - Intergenic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1146571419 17:33956559-33956581 TTGAAGGATTAGTAAGAGGTAGG - Intronic
1146639445 17:34528981-34529003 TTGAGTGATGAGGATGAGGATGG + Intergenic
1148513580 17:48194752-48194774 TTGAATTAAAAGGAAGAGGGAGG - Intronic
1149164081 17:53728683-53728705 GTAAATATTTAGGAAGAGGAAGG + Intergenic
1149399477 17:56280331-56280353 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1150800006 17:68273861-68273883 TTGAAGAACAAGGAAGGGGAAGG - Intronic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151254141 17:72862507-72862529 TTGTCTAAGTAGGAACAGGATGG - Intronic
1151791862 17:76310823-76310845 TTCAACACTTAGGAAGAGGGTGG + Exonic
1151990661 17:77571937-77571959 GTGAATATTTAGGAAGGGGATGG + Intergenic
1152572305 17:81126242-81126264 TTGAAAAATTGGGAAGACAATGG - Intronic
1152673083 17:81620666-81620688 TTTAATAATTAAAAAGAGGAGGG + Intronic
1203175162 17_KI270729v1_random:3699-3721 TTGAATAATCTGGAATAGAATGG - Intergenic
1153174070 18:2351156-2351178 TTGAATGAATAGGCACAGGACGG - Intergenic
1153243545 18:3052392-3052414 GTGAATAATTAAGAGGAAGATGG - Intergenic
1153639122 18:7139588-7139610 TTGCGTAACTAGGAAGAGAAGGG + Intergenic
1153924678 18:9825545-9825567 TTGATTCAATAGGAAGAGGCAGG + Intronic
1155562602 18:27095154-27095176 ATGAGTAATTAGCAAGATGAGGG + Intronic
1156254079 18:35378247-35378269 CTGAGGAATTAGGGAGAGGACGG + Intergenic
1156754699 18:40508253-40508275 TTGAAAAAATTGGTAGAGGATGG - Intergenic
1156759102 18:40565604-40565626 ATGAATAATCAAGAAAAGGAGGG - Intergenic
1158815222 18:61087409-61087431 ATGAAGAATTAGGAAGATGTTGG + Intergenic
1159458780 18:68695569-68695591 TTGAACAATTGGGTAGAGGGTGG - Intronic
1159496645 18:69216192-69216214 TTCAATAAGAAGGAAGGGGAGGG - Intergenic
1159611440 18:70530261-70530283 TAGAACAATGAGGCAGAGGAAGG - Intergenic
1162717461 19:12642932-12642954 TAGAAAAATTAGGGAGAGGCTGG + Intergenic
1164472433 19:28547277-28547299 CAGAATTATTTGGAAGAGGAGGG - Intergenic
1164896845 19:31884143-31884165 GTGAGTAATGAGGAAGAGGGAGG - Intergenic
1165774808 19:38398213-38398235 ATAAATAAATAGGAAGAGAAGGG - Intergenic
1166575347 19:43832101-43832123 TTGAATATTTAGGGAGAAGAGGG + Intronic
1167144321 19:47672835-47672857 CTGAATGATGAGGATGAGGATGG - Intronic
1167602859 19:50464761-50464783 TTGAAGGACAAGGAAGAGGAAGG + Intronic
1167649809 19:50723139-50723161 TCAGATAATCAGGAAGAGGATGG - Intergenic
1202705040 1_KI270713v1_random:16275-16297 TTGAATAATTAGAAATGGGAAGG + Intergenic
925434969 2:3828955-3828977 TTTGAGAATTAGGAAGCGGAGGG + Intronic
925696479 2:6585574-6585596 TAGAATAATTACAAAGAGTAGGG + Intergenic
926501045 2:13652792-13652814 TTAAATAATCAGGCAGATGAGGG + Intergenic
926772456 2:16390672-16390694 TTTAGAAATCAGGAAGAGGATGG + Intergenic
927157776 2:20231470-20231492 TTGAATAATATGGAGGAGGTGGG + Intergenic
928000664 2:27520472-27520494 GTGAAGAAGTAGGAAGGGGAGGG + Intronic
928225560 2:29445187-29445209 ATTAATAATTAGGCAGAGGTGGG + Intronic
929042244 2:37756497-37756519 TAAAAAAATTAGGAATAGGATGG - Intergenic
930445013 2:51459219-51459241 TTGAATAATTTCAAAAAGGATGG + Intergenic
930533110 2:52614693-52614715 TAGAATAACCAGGAAGAGAATGG + Intergenic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
931056307 2:58475751-58475773 TTGATAAATTAGGAAGATGTGGG + Intergenic
931138812 2:59434503-59434525 TTGAATGAAGAAGAAGAGGAAGG + Intergenic
932722797 2:74150083-74150105 TTAAATTATGGGGAAGAGGAAGG - Intergenic
936022398 2:109004875-109004897 TTCAATAATTAGGAGAGGGAGGG - Intergenic
937125146 2:119470342-119470364 TTTAATAATAAGAAATAGGATGG + Intronic
937144500 2:119631305-119631327 TTAAAAAATTAGAAAAAGGAGGG + Intronic
938189093 2:129258163-129258185 TTGAAGAATGAGGTAGAGAATGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938688936 2:133768710-133768732 TTTAAAGATTAGGAAGAGGTAGG - Intergenic
938698522 2:133855907-133855929 TTGAATAATTAGACAGAAAAAGG - Intergenic
939121148 2:138118601-138118623 TGGAAGAATTGGGAGGAGGATGG - Intergenic
939399760 2:141676691-141676713 TTTAATAATGAGGAAATGGATGG + Intronic
939496294 2:142931829-142931851 TTGAATAATTTGGCTGATGAAGG + Intronic
939850987 2:147304471-147304493 TTTTATAATTAGGAAAATGAGGG - Intergenic
940407008 2:153316296-153316318 TTGGATAATTGGGATTAGGAGGG - Intergenic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941725376 2:168854458-168854480 TTGAATAAAAAAGAATAGGATGG - Intronic
942527787 2:176873745-176873767 TTAAAAGATTATGAAGAGGAAGG - Intergenic
942573249 2:177335171-177335193 TTGAATAAATTGGAAGATGGAGG - Intronic
944378902 2:199083381-199083403 TTGAATGATTTTGAATAGGATGG - Intergenic
944411801 2:199452524-199452546 TTGAAGATTTAGGAAAAGAAGGG - Intronic
944915831 2:204359324-204359346 TTGATTAATTAGTAAGGAGATGG - Intergenic
945701555 2:213176960-213176982 TAGAACAATAAGGCAGAGGAAGG - Intergenic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
946645882 2:221833389-221833411 TTGAGGCATTAGGAAAAGGAGGG - Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947250223 2:228094628-228094650 TTAAAAAATTAGGATGAAGATGG + Intronic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
1168902637 20:1377943-1377965 TTGTTTAATTAGGAAGGTGAGGG - Intronic
1170082272 20:12490263-12490285 CTGAATAATTAGGAAGGAGAAGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170360841 20:15544399-15544421 TTGAACAGCTAGGATGAGGAGGG + Intronic
1171101496 20:22388014-22388036 GTAAATTATGAGGAAGAGGATGG + Intergenic
1171128430 20:22625497-22625519 AATAATAATAAGGAAGAGGAGGG - Intergenic
1172516239 20:35536000-35536022 TTCCATAAAAAGGAAGAGGAGGG - Intergenic
1173079998 20:39856903-39856925 ATGAAAAATAAGGGAGAGGAAGG - Intergenic
1175190204 20:57206701-57206723 TTCAATGATTAGGAAGAGCCAGG + Intronic
1176997563 21:15574473-15574495 TTGAAAAATGATGAAGGGGATGG + Intergenic
1177371627 21:20211394-20211416 TAAAATATTTAGGAAGAGTATGG + Intergenic
1177478445 21:21654187-21654209 TTGAATAATTAGTAATAAGCAGG + Intergenic
1177923236 21:27181173-27181195 TTAAAAAATTAGTTAGAGGAGGG - Intergenic
1178144694 21:29725535-29725557 ATGAACTATTGGGAAGAGGAGGG - Intronic
1178535695 21:33408495-33408517 ATGCATATTTAGGAATAGGAGGG - Intronic
1179381667 21:40904915-40904937 TTGAATAATTTCGAGGGGGAGGG + Intergenic
1181952347 22:26563632-26563654 TGGAACAATTAAGAAGAGGGAGG - Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183007419 22:34915032-34915054 TTGAATAATTCTGATGAAGAAGG - Intergenic
1183051822 22:35268863-35268885 TTCAATATGTAAGAAGAGGAAGG - Intronic
1184162375 22:42704736-42704758 TTGTATAATTTGGTAGAAGAGGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
949101738 3:154079-154101 TTGAATAATTAGGAAAAGGGTGG - Intergenic
949215558 3:1562908-1562930 TTGAATAATTAGCCAGATGCTGG + Intergenic
949375923 3:3390468-3390490 TTGAATAGTCAGGAAGAGAGGGG - Intergenic
949550539 3:5109118-5109140 TTAAATAATGAAGAAGAGGCGGG + Intergenic
949753563 3:7382646-7382668 TAGAATACATAGGAAGAGTAAGG + Intronic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
950261713 3:11546910-11546932 TTGGACAGTTAGGGAGAGGATGG - Intronic
951005449 3:17610481-17610503 TTGAAAAAGTGGGAAGAGGCTGG - Intronic
955100844 3:55848315-55848337 AAGAATAATTAGGAAAAAGAGGG - Intronic
956173162 3:66449064-66449086 TTCATTGATTAGGATGAGGAAGG + Intronic
956565889 3:70638263-70638285 TAGAATAAAAAGGCAGAGGAAGG - Intergenic
957014600 3:75048251-75048273 TTGTATAATTTGGGAGAAGATGG + Intergenic
957417613 3:79927151-79927173 GTGAATAATTGGGAAGAATAAGG + Intergenic
960141584 3:114156413-114156435 ATGAAAGATTAGGAAGAGAAAGG - Intronic
960344512 3:116515975-116515997 TGGAATAATCAAGAAGAGTATGG + Intronic
961497900 3:127307424-127307446 TTGAAACATAAGGGAGAGGAAGG - Intergenic
961853671 3:129847681-129847703 TTGAATAATTAGAAATGGAATGG + Intronic
962475145 3:135748751-135748773 TTCAAAAATTCTGAAGAGGATGG + Intergenic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
962560157 3:136597948-136597970 TTTGATAATTAGGAACAAGAGGG - Intronic
964739860 3:159954018-159954040 TTGATTAATTAAAAAGATGAAGG + Intergenic
965094527 3:164207806-164207828 TTCAATAAGTAGGAAGTAGAGGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965316348 3:167195353-167195375 TTGAGTAATTATAAACAGGAAGG + Intergenic
965499953 3:169445168-169445190 TTGCATAAGTAGGAAGACCATGG + Intronic
965975587 3:174616385-174616407 TTATTTAATTAGGAATAGGAAGG + Intronic
967478781 3:189950618-189950640 TTGAATAACTAGGAAGCAGTAGG - Intergenic
970033493 4:11704493-11704515 TTGAATAAATGAGAAGAGGTGGG - Intergenic
970943185 4:21659852-21659874 ATGATTAATTAATAAGAGGATGG + Intronic
971129878 4:23796071-23796093 ATGGATATATAGGAAGAGGATGG + Intronic
971202959 4:24529833-24529855 CTACATAATTAGGAAGAGGCAGG + Intronic
971704385 4:30020748-30020770 TTTAATAATTAGAAAGAGAGAGG - Intergenic
971768432 4:30865137-30865159 TAAAATAATTTTGAAGAGGAAGG + Intronic
972601156 4:40574060-40574082 TTAAATAATGAGGAAGAACAGGG + Intronic
972619133 4:40730025-40730047 TTGAATAAAAAAGAAGAAGAGGG + Intergenic
973239759 4:47945027-47945049 ATGAATAATTAGGAGGTTGAGGG + Intronic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
974824268 4:67106552-67106574 CTGAATAATTGGGAATAAGAGGG - Intergenic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
976998893 4:91470354-91470376 TAGTATATTTAGGAAGAAGAAGG - Intronic
977134612 4:93287968-93287990 TTTAATTATTAGGGAGAGCAAGG - Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977394834 4:96457517-96457539 TTGAAAAGTTGGTAAGAGGAAGG + Intergenic
977853289 4:101856625-101856647 TTGAAAATTTAGTAAGAGAAGGG - Intronic
977981239 4:103325007-103325029 TTGAATACAAAGGAAGATGAAGG - Intergenic
978609293 4:110519639-110519661 TTGAATAATAATGATGATGATGG - Intronic
979027147 4:115592112-115592134 TAGAACAATAAGGTAGAGGAAGG - Intergenic
979318510 4:119296661-119296683 TGGAATAAAAAGGCAGAGGAAGG - Intergenic
979994225 4:127411177-127411199 TAGAACAAATAGGTAGAGGAAGG + Intergenic
982363949 4:154554659-154554681 ATGAATAATTAAGAAGAGTAAGG + Intergenic
982452049 4:155564604-155564626 TTGACTGATTAGTAAGAGGCTGG + Intergenic
982487269 4:155981117-155981139 TTTAAAAATTAGGCAAAGGAAGG - Intergenic
983825655 4:172256143-172256165 TTGAAAAGTCAGGAAGATGATGG - Intronic
983943852 4:173564564-173564586 TTACATAATTATGAAGAGGCTGG + Intergenic
984678973 4:182585086-182585108 TTGAATAATTAAGAAAAGCCTGG + Intronic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
986034176 5:3922528-3922550 TTGCTTAATTATGAAGTGGACGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986277984 5:6297377-6297399 TTGAACAATTTAGAAGAAGAAGG - Intergenic
986757734 5:10853803-10853825 TAGAATAAAAAGGTAGAGGAAGG + Intergenic
986923829 5:12721134-12721156 TTGACTTTATAGGAAGAGGAAGG + Intergenic
987613718 5:20244521-20244543 TTGAGAAATTTGGAAGAGGAGGG - Intronic
988498051 5:31761456-31761478 TTGAATAATTAGGAGAATGTTGG + Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989242788 5:39219679-39219701 TTGAGTAATAAGGAGGAGAAAGG + Intronic
989702000 5:44279341-44279363 TAGAATAATTAGGAACATGTAGG - Intergenic
991094278 5:62722793-62722815 TTAGATAATTGGGGAGAGGAAGG + Intergenic
991559787 5:67938078-67938100 TTCATTACTTAGCAAGAGGATGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992116162 5:73540459-73540481 GTGAATACTTATGAAAAGGAAGG + Intergenic
992354221 5:75964196-75964218 TTTAATAATTAGGAAGTGAGAGG + Intergenic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
992845442 5:80742346-80742368 TTGATGAATTAGGAAGATAACGG + Intronic
992952258 5:81871590-81871612 TTTAATAATTAGGATAAAGAAGG + Intergenic
993377140 5:87161841-87161863 TTGAATCATTGGGAAAAGGATGG + Intergenic
993475371 5:88357866-88357888 TTGAACAAAAAGGCAGAGGATGG - Intergenic
993854819 5:93061080-93061102 ATCAAGAATTAGGAAGAGGAGGG - Intergenic
993926200 5:93869411-93869433 TTGAAGAATTAGGAAGAGCTTGG + Intronic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
994914344 5:105954340-105954362 TTGAATAATTTGGAACAGGTTGG - Intergenic
995437855 5:112158103-112158125 TTCCAAAATTAGGCAGAGGAAGG - Intronic
995496436 5:112749430-112749452 TTGAAGGATTTGGAGGAGGAGGG + Intronic
996471645 5:123867882-123867904 TTTCAAAATTAGAAAGAGGAAGG + Intergenic
997069675 5:130606655-130606677 TTGGGTACTTAGAAAGAGGAAGG - Intergenic
997862282 5:137428768-137428790 TGGAGGAATTAGGAAGAGGGAGG - Intronic
997902025 5:137775527-137775549 TTCAGTAATGAGGGAGAGGATGG + Intergenic
997930626 5:138069764-138069786 TTGAGTCAGTAGGAAGAAGAGGG - Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
999146196 5:149396963-149396985 TTGAATAATTTGGCAGGAGAGGG + Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999394768 5:151220525-151220547 GTGAATGATAAGGAAGAGGCTGG - Intronic
1000376826 5:160590361-160590383 TTTCATAATTAGCAAGATGATGG - Intronic
1001024143 5:168208862-168208884 TGGAATATTTAGGATGAGAAAGG + Intronic
1002877613 6:1225552-1225574 TCGAAAGATTAGGAAAAGGAAGG + Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003363815 6:5453842-5453864 TTGAATAATGAGGAACCGTACGG + Intronic
1004185926 6:13421096-13421118 TTGAATAATTAAAGAGAGTATGG + Intronic
1005600989 6:27425786-27425808 TGGAAACACTAGGAAGAGGATGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1006713870 6:36101137-36101159 TGCAATAATTAAGAAGCGGAAGG + Intronic
1007442157 6:41871582-41871604 TGGAATAATATGGAAGAAGATGG - Exonic
1007760903 6:44133300-44133322 TTGAAGTGTTAGGAAGAGGCAGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008101782 6:47399490-47399512 TTGAATAGTTAGGAACATAAAGG - Intergenic
1008555430 6:52669382-52669404 TTGAATATGTGGGAACAGGATGG - Intergenic
1008939171 6:57027911-57027933 TTTAATAAGTAGGGAAAGGAAGG + Intergenic
1009291025 6:61882519-61882541 TTGATCAATTTGGTAGAGGAAGG - Intronic
1009589772 6:65652607-65652629 TTGAATAATTTAGAAGAAGATGG + Intronic
1010304018 6:74296109-74296131 TTCAATAATAAGGAGTAGGAAGG - Intergenic
1010491402 6:76480603-76480625 TAAAAAAATTAGGAAGAGGAAGG + Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1011045607 6:83078559-83078581 TTGTGTAATTAGGAAGATGATGG + Intronic
1011360414 6:86518326-86518348 TAAAATAAGTTGGAAGAGGAAGG + Intergenic
1011840917 6:91497844-91497866 AGAAATAAATAGGAAGAGGAAGG - Intergenic
1012011038 6:93785737-93785759 TTATATAATTTGGAAAAGGAAGG - Intergenic
1012736775 6:102957564-102957586 TTAAAGAAGTAGGAAAAGGACGG - Intergenic
1013718981 6:113000128-113000150 TTTAATAATGAGGAAGAAGAGGG + Intergenic
1014074525 6:117221092-117221114 TTGAATCATAATCAAGAGGAAGG + Intergenic
1014665518 6:124232107-124232129 TTGAGAAATTAGGCAGAGAATGG - Intronic
1015186979 6:130428727-130428749 TTTTAAAATTAGGAAAAGGAAGG + Intronic
1015797399 6:137026839-137026861 ATATATAATTAGGAAGAAGAAGG - Intronic
1016356713 6:143226538-143226560 TTAAAAAGTTAAGAAGAGGACGG - Intronic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017187623 6:151618000-151618022 TTTCATAATCAGGAAGAGCAAGG - Exonic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018962351 6:168457814-168457836 TAGACTCATTAGAAAGAGGAGGG - Intronic
1019073023 6:169365581-169365603 TCCAATAATCAGGAAGAAGAGGG + Intergenic
1021060709 7:16106720-16106742 TTTAATAATTATGAAGAATAAGG + Intronic
1021273061 7:18616112-18616134 TTAAAAAATAAGGAAGAGGGAGG - Intronic
1022353798 7:29591763-29591785 TTGAAAAACTAGGAACAGAAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024092586 7:45957154-45957176 TTTAAAAAGTAGTAAGAGGAAGG - Intergenic
1024497504 7:50065201-50065223 TAGAGGAATTAGAAAGAGGAAGG + Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024889971 7:54188825-54188847 TTGCAAAATTAGGAAGAGTGTGG + Intergenic
1026047430 7:66916513-66916535 TTAAAAAATTAGGCAGAGCATGG - Intergenic
1027520307 7:79198587-79198609 TTGAATAAAAAGTAAGAGGTAGG + Intronic
1027683510 7:81251542-81251564 TTGAATCCTTAGGAAGAAAAAGG + Intergenic
1028256630 7:88606880-88606902 TTGTATAATTAGGTCAAGGATGG - Intergenic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1029835738 7:103307854-103307876 TTAAAGAATACGGAAGAGGAAGG - Intronic
1030283173 7:107798040-107798062 TTCTATAATTAGTAAGAGGAAGG - Intronic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030765898 7:113409261-113409283 TTGAATAAAAAGGTAGAGGAAGG + Intergenic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030954743 7:115838092-115838114 TTGAATAATGAGACACAGGAAGG - Intergenic
1031081323 7:117259853-117259875 TTCAATTCTTAGGAAGATGAGGG - Intergenic
1031200423 7:118677066-118677088 TTGAGGAGATAGGAAGAGGAAGG - Intergenic
1031452490 7:121938823-121938845 ATGCATAATTAGGAAGTGTAAGG - Intronic
1032871050 7:135985828-135985850 TTGAATAATTAGGAAGAGTGTGG + Intergenic
1033064666 7:138143120-138143142 TTTAAAAATTGGGAACAGGAAGG - Intergenic
1033234246 7:139625622-139625644 GTGAAGGATGAGGAAGAGGATGG - Intronic
1034867528 7:154654988-154655010 TTGAATAATTAATTAGTGGATGG - Intronic
1035562997 8:621521-621543 TTAAATAATTAAAAAGAGAAAGG + Intronic
1041880302 8:62741963-62741985 TTGTAGAATAAGGAAGAAGAGGG - Intronic
1042388282 8:68202961-68202983 TGGAACAAAAAGGAAGAGGAAGG - Intronic
1042711766 8:71725396-71725418 TGGGATAATAAGGAAGAGGAAGG + Intergenic
1043909404 8:85843323-85843345 TTGAAGAAATAAGTAGAGGAAGG - Intergenic
1044112984 8:88299460-88299482 TTTAAAAATTAGGAAGAAGTGGG - Intronic
1044339939 8:91035566-91035588 TTTAATGACTAGGGAGAGGAAGG - Intronic
1044557964 8:93585292-93585314 AGTAATCATTAGGAAGAGGATGG + Intergenic
1044584374 8:93855961-93855983 AAGAATGATGAGGAAGAGGATGG - Intergenic
1044991650 8:97801469-97801491 TTGAAAAATTATGAAGAGCTGGG - Intronic
1045467342 8:102482470-102482492 TAGAATAAAAAGGCAGAGGAAGG + Intergenic
1045974673 8:108118478-108118500 TAGAATAATTAGGTAAATGACGG - Intergenic
1046337596 8:112810230-112810252 TTAAAAAATTAGTAAGAAGATGG - Intronic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047091214 8:121577824-121577846 ATGAAAAATGAGGAAGAGAAAGG + Intergenic
1047354009 8:124103035-124103057 TTGAATGAGTAGGAAGTGAAGGG + Intronic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1048903728 8:139066398-139066420 TAGAATAAATATGAAGGGGATGG + Intergenic
1050169812 9:2803578-2803600 TTGAATAAGAAGGAAGAAGGTGG - Intronic
1050847275 9:10237652-10237674 TTGCAGACCTAGGAAGAGGAGGG - Intronic
1051890147 9:21932885-21932907 CAGAGTAATTAGGCAGAGGAGGG - Intronic
1052907672 9:33850782-33850804 GTGAATAATGGGGAAGAGTAGGG - Intronic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1055144937 9:72922013-72922035 TGGAATAATCAGGAAGAGATGGG + Intronic
1056045107 9:82706453-82706475 TTGCATTATTAGGAATAAGATGG + Intergenic
1056268968 9:84927653-84927675 TTGTATAATTAGTAAGAGGCAGG - Intronic
1057203710 9:93157997-93158019 ATAAATAAATAGGAAGGGGAAGG - Intergenic
1057971503 9:99562766-99562788 TTAGAAAATTAGGAAGAGTAAGG + Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058243106 9:102591848-102591870 TTGTATAATGAGAAATAGGAGGG - Intergenic
1058746903 9:108000556-108000578 TCGAACAACTAGGAAGAGGTTGG + Intergenic
1059485687 9:114624912-114624934 TTGAATAAATAGGAATATGCTGG + Intronic
1059796112 9:117698654-117698676 ATGAATAAATAGGCAAAGGATGG - Intergenic
1059947136 9:119421096-119421118 TTTATTAATGAGAAAGAGGAAGG + Intergenic
1060558203 9:124521069-124521091 TTGACTAAATAGGCAGAAGAAGG + Exonic
1061102275 9:128501197-128501219 TTTAGCTATTAGGAAGAGGATGG + Exonic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1187850095 X:23583194-23583216 TTTAATTATGAGGCAGAGGAGGG - Intergenic
1192231693 X:69269685-69269707 TTGACTATTTAGTTAGAGGATGG - Intergenic
1193596634 X:83453820-83453842 TTGAAAAATTTGCATGAGGAAGG + Intergenic
1194671033 X:96733034-96733056 TTGAATATTTATGAACAGGAGGG + Intronic
1195866016 X:109433579-109433601 ATGAATAATGAGGAAAAGGGAGG + Intronic
1196239790 X:113329772-113329794 TTGAACAAAAAGGCAGAGGAAGG - Intergenic
1196361976 X:114872155-114872177 GTGAATAAATGGGAGGAGGAAGG - Intronic
1196872710 X:120127849-120127871 TTGAATAACAAGGACGAGGGTGG + Intergenic
1197664839 X:129212410-129212432 AAGAATTATGAGGAAGAGGAAGG + Intergenic
1197859464 X:130954631-130954653 TTAGAAAATTAGGAATAGGAGGG - Intergenic
1198170352 X:134099296-134099318 TAGAATAAAAAGGCAGAGGAGGG + Intergenic
1199286006 X:146054895-146054917 TCAAATAAAAAGGAAGAGGAAGG + Intergenic