ID: 949789899

View in Genome Browser
Species Human (GRCh38)
Location 3:7781587-7781609
Sequence CAGCCCTCTACCAGCTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949789899_949789901 0 Left 949789899 3:7781587-7781609 CCAAAGCAGCTGGTAGAGGGCTG No data
Right 949789901 3:7781610-7781632 AGCCCAGGAAAAGCACTGTGAGG No data
949789899_949789906 27 Left 949789899 3:7781587-7781609 CCAAAGCAGCTGGTAGAGGGCTG No data
Right 949789906 3:7781637-7781659 CTCTTACGAGATCCCCCACTAGG No data
949789899_949789905 4 Left 949789899 3:7781587-7781609 CCAAAGCAGCTGGTAGAGGGCTG No data
Right 949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG No data
949789899_949789904 3 Left 949789899 3:7781587-7781609 CCAAAGCAGCTGGTAGAGGGCTG No data
Right 949789904 3:7781613-7781635 CCAGGAAAAGCACTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949789899 Original CRISPR CAGCCCTCTACCAGCTGCTT TGG (reversed) Intergenic
No off target data available for this crispr