ID: 949789905

View in Genome Browser
Species Human (GRCh38)
Location 3:7781614-7781636
Sequence CAGGAAAAGCACTGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949789899_949789905 4 Left 949789899 3:7781587-7781609 CCAAAGCAGCTGGTAGAGGGCTG No data
Right 949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949789905 Original CRISPR CAGGAAAAGCACTGTGAGGA GGG Intergenic
No off target data available for this crispr