ID: 949792712

View in Genome Browser
Species Human (GRCh38)
Location 3:7810667-7810689
Sequence CTCTGTCAGTAGAAGCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949792712_949792715 28 Left 949792712 3:7810667-7810689 CCTTAATGCTTCTACTGACAGAG No data
Right 949792715 3:7810718-7810740 TTTGCGCATCAAAAAAGTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949792712 Original CRISPR CTCTGTCAGTAGAAGCATTA AGG (reversed) Intergenic
No off target data available for this crispr