ID: 949792776

View in Genome Browser
Species Human (GRCh38)
Location 3:7811555-7811577
Sequence ATGATGAATTCAATCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949792776_949792781 26 Left 949792776 3:7811555-7811577 CCACCACTGATTGAATTCATCAT No data
Right 949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG No data
949792776_949792782 27 Left 949792776 3:7811555-7811577 CCACCACTGATTGAATTCATCAT No data
Right 949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG No data
949792776_949792779 10 Left 949792776 3:7811555-7811577 CCACCACTGATTGAATTCATCAT No data
Right 949792779 3:7811588-7811610 GAAAACCTCAATAAAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949792776 Original CRISPR ATGATGAATTCAATCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr