ID: 949792778

View in Genome Browser
Species Human (GRCh38)
Location 3:7811579-7811601
Sequence TTATTGAGGTTTTCTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949792778_949792783 18 Left 949792778 3:7811579-7811601 CCTACATAAGAAAACCTCAATAA No data
Right 949792783 3:7811620-7811642 CTCAAGGGAACTTCCCTAGTTGG No data
949792778_949792782 3 Left 949792778 3:7811579-7811601 CCTACATAAGAAAACCTCAATAA No data
Right 949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG No data
949792778_949792781 2 Left 949792778 3:7811579-7811601 CCTACATAAGAAAACCTCAATAA No data
Right 949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949792778 Original CRISPR TTATTGAGGTTTTCTTATGT AGG (reversed) Intergenic
No off target data available for this crispr