ID: 949792779

View in Genome Browser
Species Human (GRCh38)
Location 3:7811588-7811610
Sequence GAAAACCTCAATAAAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949792777_949792779 7 Left 949792777 3:7811558-7811580 CCACTGATTGAATTCATCATGCC No data
Right 949792779 3:7811588-7811610 GAAAACCTCAATAAAATCTCTGG No data
949792776_949792779 10 Left 949792776 3:7811555-7811577 CCACCACTGATTGAATTCATCAT No data
Right 949792779 3:7811588-7811610 GAAAACCTCAATAAAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949792779 Original CRISPR GAAAACCTCAATAAAATCTC TGG Intergenic