ID: 949792781

View in Genome Browser
Species Human (GRCh38)
Location 3:7811604-7811626
Sequence TCTCTGGACACTAAAGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949792776_949792781 26 Left 949792776 3:7811555-7811577 CCACCACTGATTGAATTCATCAT No data
Right 949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG No data
949792777_949792781 23 Left 949792777 3:7811558-7811580 CCACTGATTGAATTCATCATGCC No data
Right 949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG No data
949792778_949792781 2 Left 949792778 3:7811579-7811601 CCTACATAAGAAAACCTCAATAA No data
Right 949792781 3:7811604-7811626 TCTCTGGACACTAAAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949792781 Original CRISPR TCTCTGGACACTAAAGCTCA AGG Intergenic