ID: 949793173

View in Genome Browser
Species Human (GRCh38)
Location 3:7815998-7816020
Sequence AAAGGTTATAATTTATTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949793173_949793177 27 Left 949793173 3:7815998-7816020 CCTTACAATAAATTATAACCTTT No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949793173 Original CRISPR AAAGGTTATAATTTATTGTA AGG (reversed) Intergenic
No off target data available for this crispr