ID: 949793175

View in Genome Browser
Species Human (GRCh38)
Location 3:7816021-7816043
Sequence CATCTGTTAATGAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949793175_949793177 4 Left 949793175 3:7816021-7816043 CCTTTTGTCCTCATTAACAGATG No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data
949793175_949793178 15 Left 949793175 3:7816021-7816043 CCTTTTGTCCTCATTAACAGATG No data
Right 949793178 3:7816059-7816081 TATCACCCTTGGAAATTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949793175 Original CRISPR CATCTGTTAATGAGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr