ID: 949793176

View in Genome Browser
Species Human (GRCh38)
Location 3:7816029-7816051
Sequence AAACTCAGCATCTGTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949793176_949793178 7 Left 949793176 3:7816029-7816051 CCTCATTAACAGATGCTGAGTTT No data
Right 949793178 3:7816059-7816081 TATCACCCTTGGAAATTCTCCGG No data
949793176_949793177 -4 Left 949793176 3:7816029-7816051 CCTCATTAACAGATGCTGAGTTT No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949793176 Original CRISPR AAACTCAGCATCTGTTAATG AGG (reversed) Intergenic
No off target data available for this crispr