ID: 949793177

View in Genome Browser
Species Human (GRCh38)
Location 3:7816048-7816070
Sequence GTTTTGACATTTATCACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949793175_949793177 4 Left 949793175 3:7816021-7816043 CCTTTTGTCCTCATTAACAGATG No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data
949793174_949793177 9 Left 949793174 3:7816016-7816038 CCTTTCCTTTTGTCCTCATTAAC No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data
949793173_949793177 27 Left 949793173 3:7815998-7816020 CCTTACAATAAATTATAACCTTT No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data
949793176_949793177 -4 Left 949793176 3:7816029-7816051 CCTCATTAACAGATGCTGAGTTT No data
Right 949793177 3:7816048-7816070 GTTTTGACATTTATCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949793177 Original CRISPR GTTTTGACATTTATCACCCT TGG Intergenic
No off target data available for this crispr