ID: 949793178

View in Genome Browser
Species Human (GRCh38)
Location 3:7816059-7816081
Sequence TATCACCCTTGGAAATTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949793176_949793178 7 Left 949793176 3:7816029-7816051 CCTCATTAACAGATGCTGAGTTT No data
Right 949793178 3:7816059-7816081 TATCACCCTTGGAAATTCTCCGG No data
949793174_949793178 20 Left 949793174 3:7816016-7816038 CCTTTCCTTTTGTCCTCATTAAC No data
Right 949793178 3:7816059-7816081 TATCACCCTTGGAAATTCTCCGG No data
949793175_949793178 15 Left 949793175 3:7816021-7816043 CCTTTTGTCCTCATTAACAGATG No data
Right 949793178 3:7816059-7816081 TATCACCCTTGGAAATTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949793178 Original CRISPR TATCACCCTTGGAAATTCTC CGG Intergenic
No off target data available for this crispr