ID: 949797020

View in Genome Browser
Species Human (GRCh38)
Location 3:7862577-7862599
Sequence CCTTAGAGGGAGCGACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949797011_949797020 21 Left 949797011 3:7862533-7862555 CCAGTGGGCTCTAGAAATCACAC No data
Right 949797020 3:7862577-7862599 CCTTAGAGGGAGCGACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949797020 Original CRISPR CCTTAGAGGGAGCGACTGGC TGG Intergenic
No off target data available for this crispr