ID: 949799932

View in Genome Browser
Species Human (GRCh38)
Location 3:7892636-7892658
Sequence GAATGTTTTACCTAGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949799931_949799932 -3 Left 949799931 3:7892616-7892638 CCATAGTATCTGGTGCTTAAGAA No data
Right 949799932 3:7892636-7892658 GAATGTTTTACCTAGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949799932 Original CRISPR GAATGTTTTACCTAGCAGCC TGG Intergenic
No off target data available for this crispr