ID: 949801820

View in Genome Browser
Species Human (GRCh38)
Location 3:7912495-7912517
Sequence CTCTGGTTTTGGGGGTGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949801820_949801827 -6 Left 949801820 3:7912495-7912517 CCCTATCACCCCCAAAACCAGAG No data
Right 949801827 3:7912512-7912534 CCAGAGCAGAAGCCAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949801820 Original CRISPR CTCTGGTTTTGGGGGTGATA GGG (reversed) Intergenic
No off target data available for this crispr