ID: 949809008 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:7985858-7985880 |
| Sequence | CTGTACACACAGCTAGTAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949809008_949809011 | 18 | Left | 949809008 | 3:7985858-7985880 | CCCTCTACTAGCTGTGTGTACAG | No data | ||
| Right | 949809011 | 3:7985899-7985921 | CTGTGCCCAGAGCCAAGCCCAGG | No data | ||||
| 949809008_949809010 | -5 | Left | 949809008 | 3:7985858-7985880 | CCCTCTACTAGCTGTGTGTACAG | No data | ||
| Right | 949809010 | 3:7985876-7985898 | TACAGTCAACTAAAGACAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949809008 | Original CRISPR | CTGTACACACAGCTAGTAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||