ID: 949809008

View in Genome Browser
Species Human (GRCh38)
Location 3:7985858-7985880
Sequence CTGTACACACAGCTAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949809008_949809011 18 Left 949809008 3:7985858-7985880 CCCTCTACTAGCTGTGTGTACAG No data
Right 949809011 3:7985899-7985921 CTGTGCCCAGAGCCAAGCCCAGG No data
949809008_949809010 -5 Left 949809008 3:7985858-7985880 CCCTCTACTAGCTGTGTGTACAG No data
Right 949809010 3:7985876-7985898 TACAGTCAACTAAAGACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949809008 Original CRISPR CTGTACACACAGCTAGTAGA GGG (reversed) Intergenic
No off target data available for this crispr