ID: 949811181

View in Genome Browser
Species Human (GRCh38)
Location 3:8007927-8007949
Sequence GCTTTAGTACTGAAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949811181_949811185 13 Left 949811181 3:8007927-8007949 CCATGTTCCTTCAGTACTAAAGC No data
Right 949811185 3:8007963-8007985 TGTGCATCTCAGTAAGGAGCTGG No data
949811181_949811184 7 Left 949811181 3:8007927-8007949 CCATGTTCCTTCAGTACTAAAGC No data
Right 949811184 3:8007957-8007979 AACAGCTGTGCATCTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949811181 Original CRISPR GCTTTAGTACTGAAGGAACA TGG (reversed) Intergenic
No off target data available for this crispr