ID: 949813903

View in Genome Browser
Species Human (GRCh38)
Location 3:8038414-8038436
Sequence TTGAGCAGGAATAAAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949813901_949813903 -6 Left 949813901 3:8038397-8038419 CCAGGGACTCGGAGATCTTGAGC No data
Right 949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG No data
949813898_949813903 11 Left 949813898 3:8038380-8038402 CCAAGATTAAAACAGCTCCAGGG No data
Right 949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949813903 Original CRISPR TTGAGCAGGAATAAAAATCC AGG Intergenic
No off target data available for this crispr