ID: 949820148

View in Genome Browser
Species Human (GRCh38)
Location 3:8107150-8107172
Sequence CAGGATCTGCAGCTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 14, 3: 91, 4: 519}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949820142_949820148 14 Left 949820142 3:8107113-8107135 CCTTCAGACTTGGATTAGAACTA 0: 1
1: 1
2: 22
3: 75
4: 306
Right 949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG 0: 1
1: 0
2: 14
3: 91
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949820148 Original CRISPR CAGGATCTGCAGCTTGTAGA TGG Intergenic
900641903 1:3691569-3691591 AAGGGTCTGCAGCTTGTGGTTGG + Intronic
900717450 1:4154003-4154025 TTGCATCTCCAGCTTGTAGACGG - Intergenic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
901251081 1:7780944-7780966 CAGGATCCACAGCTTAAAGATGG + Exonic
901348413 1:8568360-8568382 CCGCATCTCCAGCTTGCAGATGG + Intronic
901445225 1:9304306-9304328 CTGGGTCTCCAGCTTGCAGATGG + Intronic
902259965 1:15217555-15217577 CTGGGTCTGCAGCTTACAGATGG - Intronic
903223865 1:21884265-21884287 CAGGATCTGAAGCTGGAAGCTGG + Intronic
903611895 1:24621000-24621022 TAGGAGCTGCAGCATATAGATGG - Intergenic
904002935 1:27349106-27349128 CAGGATCTGAAGCCTTTAGGGGG - Exonic
904651529 1:32009464-32009486 CAGGGTCTCCAGCTTGCAGAAGG + Intergenic
904879387 1:33683947-33683969 CAGGTTCAGCAGCTTCCAGAGGG - Intronic
906260839 1:44388482-44388504 TAGGATCTACAGCTTGTGGAAGG - Intergenic
907854806 1:58292190-58292212 CTGGGTCTCCAGCTTGCAGATGG + Intronic
908687583 1:66739459-66739481 CAGGAACTGCACATTGTTGAGGG - Exonic
909289232 1:73861256-73861278 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
909834929 1:80242002-80242024 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
910118454 1:83758133-83758155 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
910262686 1:85307321-85307343 CTGGATCTGCAGTGTGTTGACGG + Intergenic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
911227629 1:95324492-95324514 CAGAAACTGAAGGTTGTAGAGGG - Intergenic
911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG + Intronic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
912344120 1:108948277-108948299 CAGGAACTGCAGCTTCTCCAGGG + Intronic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
913273528 1:117117088-117117110 CAGGATCTGGAGCTTAGGGAGGG - Intronic
913281552 1:117189942-117189964 CTGGATCTGTAGCTTGTGGTGGG - Intronic
914461007 1:147885131-147885153 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
915324727 1:155075486-155075508 CAGGTTCTGCACCTTGCACAGGG - Intergenic
915849526 1:159306310-159306332 GAGCAGTTGCAGCTTGTAGAAGG + Intronic
916635327 1:166662006-166662028 CAGGGTCTCCATCTTGCAGATGG + Intergenic
916963376 1:169911198-169911220 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
918533396 1:185548238-185548260 AAGGGTCTCCAGCTTGCAGATGG - Intergenic
918638670 1:186811715-186811737 CTAGTTCTCCAGCTTGTAGATGG - Intergenic
919019601 1:192087561-192087583 CTGGTTCTTCAGCTTGCAGATGG - Intergenic
919310073 1:195895913-195895935 CAGGATCTTCAGCTTACAGATGG - Intergenic
919405739 1:197180790-197180812 CAAGATTTGCAGGTTTTAGATGG - Intronic
920744463 1:208613481-208613503 CAGGATCTGCAGCTTGCCAGGGG - Intergenic
921467472 1:215506451-215506473 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
922039607 1:221883833-221883855 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
922528494 1:226325084-226325106 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
922535688 1:226379162-226379184 CAGAAGCTGCAGCTTGTAGTAGG + Exonic
922549083 1:226480770-226480792 CAGGGTCTCCAGCTTGCGGATGG + Intergenic
922785967 1:228282361-228282383 CAGGCCCTGCGGCTTCTAGAAGG - Intronic
923791665 1:237116634-237116656 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1062820489 10:531025-531047 CAGGGTCTGCAGCTTTTGGCGGG - Intronic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1064236715 10:13582709-13582731 CAGGTTCTTCAGCTTGCAGAAGG + Intergenic
1064493356 10:15883579-15883601 CTGGATCTCCAGCTTGCAGGTGG - Intergenic
1064648505 10:17484642-17484664 CTGGGTCTCCAGCTTGCAGAAGG - Intergenic
1064692462 10:17931932-17931954 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1064909307 10:20383132-20383154 CTGTTTCTCCAGCTTGTAGATGG + Intergenic
1065386396 10:25137974-25137996 CTGGGTCTACAGCTTGTGGATGG - Intergenic
1065432798 10:25676483-25676505 CTGGATCTCCAGCTTGCAGACGG - Intergenic
1065845454 10:29739228-29739250 CTGGATCTGGAGCTTGGGGAGGG - Intergenic
1065867363 10:29925682-29925704 CTGGGTCTCCAGCTTGCAGAAGG + Intergenic
1065875154 10:29991495-29991517 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067665916 10:48279123-48279145 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067823806 10:49554798-49554820 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1068391228 10:56399392-56399414 CTGGGTCTACAGCTTATAGAGGG + Intergenic
1069045494 10:63738753-63738775 TATGGTCTGCAGCTTGCAGATGG + Intergenic
1069575137 10:69521805-69521827 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1070363959 10:75717674-75717696 CAGCAACTGCAGCTTGTGCAGGG - Intronic
1070708841 10:78662336-78662358 CAGGGTCTAGAGCTTATAGAAGG - Intergenic
1071374280 10:84986772-84986794 CTTGCTCTTCAGCTTGTAGATGG - Intergenic
1071946755 10:90654836-90654858 CTGGTTCTCTAGCTTGTAGATGG - Intergenic
1072171314 10:92864840-92864862 CTGGTTCTCCAGCTTGCAGACGG + Intronic
1072277786 10:93839826-93839848 CAGGGTCTACAGCTTGCAGATGG - Intergenic
1073878043 10:107948454-107948476 CTGGACTTCCAGCTTGTAGATGG - Intergenic
1073899767 10:108206412-108206434 CTGGCTCTCAAGCTTGTAGATGG - Intergenic
1074049238 10:109867370-109867392 TGGGTTATGCAGCTTGTAGATGG - Intronic
1074219737 10:111424773-111424795 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1075128534 10:119720596-119720618 CTGGTTCTCCAGCTTGCAGAAGG - Intergenic
1075134362 10:119769833-119769855 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1075158478 10:120001693-120001715 CGGGTTCTCCAGCTTGCAGACGG - Intergenic
1075201096 10:120404882-120404904 CTGGTTCTCCAGCTTGCAGAAGG + Intergenic
1075270705 10:121047715-121047737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1075403459 10:122177805-122177827 CAGGATCTGGAGCTTCTAGCAGG - Intronic
1075947983 10:126454461-126454483 CAGCCTTTGCAGATTGTAGAAGG - Intronic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076435585 10:130439002-130439024 CAGGCCCTGCAGCTGGGAGAGGG - Intergenic
1076591898 10:131589140-131589162 CAGGGTCTGCAGCTCGTGAAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077399287 11:2345790-2345812 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1077832260 11:5886104-5886126 CTTGATCTTCAGCTTGCAGATGG + Intronic
1078486817 11:11730945-11730967 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1079908546 11:26280407-26280429 CTCGCTCTTCAGCTTGTAGATGG - Intergenic
1080248051 11:30201640-30201662 CAGGTTCTCCAGCTTACAGATGG + Intergenic
1081243784 11:40738308-40738330 CAGGGTCTTCAGTTTGCAGATGG + Intronic
1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG + Intronic
1081359199 11:42152458-42152480 TCAGATCTCCAGCTTGTAGAGGG + Intergenic
1081539777 11:44024317-44024339 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1083158673 11:60841385-60841407 GAGGATATGCAGCTGGTCGAGGG + Intergenic
1083163260 11:60868459-60868481 TTGGATCTGCAGCTTCTAAACGG + Intronic
1083230426 11:61314331-61314353 ATGGATCTGCAGATAGTAGAGGG + Exonic
1083289724 11:61683043-61683065 CAGGCTCTGCAGCTTGTTGTCGG - Intronic
1084469734 11:69352064-69352086 CTGGGTCTCCAGCTTGCAGAGGG - Intronic
1085260612 11:75202714-75202736 CAGGCTCTGCAGGTTGAAAAAGG + Intronic
1086407892 11:86514676-86514698 GAGGAACTGAAGCTTGAAGAAGG - Intronic
1086490094 11:87350326-87350348 TAGGGTCTCCAGCTTGCAGACGG + Intergenic
1086535177 11:87835687-87835709 CTGTTTCTTCAGCTTGTAGATGG - Intergenic
1087575170 11:99981188-99981210 CAGGGTCTTTAGCTTGCAGATGG - Intronic
1087624312 11:100579662-100579684 CTGGTTCTGCAGCTTGCAGATGG - Intergenic
1087982425 11:104632349-104632371 CAGGTTATTCAGCTTGCAGATGG + Intergenic
1089649459 11:119903142-119903164 CAGAGTCTCCAGCTTGCAGATGG - Intergenic
1091103201 11:132894879-132894901 CAGGATCCCCAGCATGTAGATGG + Intronic
1091964308 12:4724970-4724992 CAGGGTCAGCAGCTTGGTGAGGG - Intronic
1092643574 12:10543814-10543836 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1092813993 12:12297159-12297181 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093010181 12:14099336-14099358 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093160347 12:15739679-15739701 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1093828950 12:23731271-23731293 CAGGGTCTCCAGCTTGCAGAAGG + Intronic
1095424395 12:42060002-42060024 CAGGTTCTCCAGCTTGCAGAGGG + Intergenic
1096239334 12:49951210-49951232 CAGGACCTGCCCCTTGTGGATGG - Intronic
1096584546 12:52611304-52611326 CAGGAGCTGCAGCTAGCAGCCGG - Exonic
1097750747 12:63349489-63349511 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1098158697 12:67626324-67626346 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1098231459 12:68375694-68375716 CAGGATCTCCAGCTTGAAGGGGG - Intergenic
1098410714 12:70180483-70180505 CTGGCTTTCCAGCTTGTAGATGG + Intergenic
1098763881 12:74460172-74460194 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1099580195 12:84436255-84436277 CTGGTTCTCCAGCTTGCAGAAGG - Intergenic
1099868922 12:88321426-88321448 CTGGCTCTTCAGCTTGCAGATGG + Intergenic
1099879743 12:88454104-88454126 GTGGATCTCCAGCTTGCAGAGGG - Intergenic
1100213394 12:92421780-92421802 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1101036511 12:100712953-100712975 CTGGGTCTTCAGCTTGCAGATGG - Intergenic
1102677188 12:114666946-114666968 CAGGAGCTGCAGGTGTTAGAAGG - Intergenic
1102863692 12:116357652-116357674 CTGGGTCTTCAGCTTGCAGATGG - Intergenic
1104908134 12:132226298-132226320 CAGTATGTGCAGCGTGTATATGG - Intronic
1104913008 12:132248948-132248970 CAGGATCTGCAGAGTGGAGCGGG + Intronic
1104927102 12:132319495-132319517 CCGGGCCTGCAGCTTGCAGACGG + Intronic
1105563835 13:21523186-21523208 CTGGGTCTACAGCTTGCAGATGG + Intronic
1106076698 13:26466540-26466562 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1107586774 13:41858098-41858120 CTGGCTCTCCAGCTTGCAGATGG + Intronic
1107676805 13:42806167-42806189 CAGAGTCTCCAGCTTGCAGATGG + Intergenic
1107994198 13:45844548-45844570 CAGGGTCTCTAGCTTGCAGATGG + Intronic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1109273888 13:60283220-60283242 CTGGACCTCCAGCTTGCAGATGG - Intergenic
1109507817 13:63329569-63329591 CTGGATCTTCATCTTGCAGAAGG + Intergenic
1110065369 13:71098406-71098428 CTGGTTCTCCAGCTTGTAGATGG - Intergenic
1110187286 13:72690359-72690381 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1110541799 13:76714135-76714157 CTGGTTCTCCAGCTTGCAGAGGG + Intergenic
1112802662 13:103129726-103129748 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1112988385 13:105480627-105480649 CAGGATCTCCAGCTTGCAGATGG - Intronic
1113302628 13:109038533-109038555 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1115310477 14:31974082-31974104 CAGGAGCTGCAGGTTGGAGTGGG - Intergenic
1116861292 14:49997669-49997691 CTGGGTCTCCAGCTTGTAGATGG + Intronic
1116916901 14:50533346-50533368 CCTTATCTGCAGCTTGAAGAGGG + Intronic
1117298951 14:54405019-54405041 CAGAATCTGCAGTGTTTAGAGGG - Intronic
1117906035 14:60588441-60588463 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1118427310 14:65680137-65680159 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1118934063 14:70269876-70269898 CAAGGTCTCCAGCTTGCAGATGG + Intergenic
1119118007 14:72045061-72045083 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1119802385 14:77457565-77457587 CAGGCTGTGCAGCTTAGAGAAGG + Exonic
1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1120362137 14:83518153-83518175 CATAATCTCCAGCTTGCAGAAGG + Intergenic
1120362146 14:83518435-83518457 CAGGGTCTCCAGCTTGCAGAAGG - Intergenic
1120362693 14:83525703-83525725 CAGCATCTTCAGCTTGTGGATGG - Intergenic
1120394186 14:83946518-83946540 CTGGGTCTTCAGGTTGTAGATGG + Intergenic
1120484367 14:85092441-85092463 CTGGGTCTTCAGCTTGCAGATGG + Intergenic
1120671928 14:87372545-87372567 CTGGTTCTTGAGCTTGTAGATGG + Intergenic
1120728271 14:87971231-87971253 CAGGATCAGCAGATGGTATATGG + Intronic
1121227806 14:92334246-92334268 CAGGATGTCCAGCCTGGAGAGGG + Intronic
1121368705 14:93337612-93337634 CAGGAGCTGCAGCCTGGAGTGGG + Intronic
1121486182 14:94316990-94317012 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1121710442 14:96034758-96034780 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1121739437 14:96241050-96241072 CATGATCTGCATCGTGCAGAAGG - Exonic
1122841901 14:104469379-104469401 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1123018389 14:105386308-105386330 CAGGCTCTGCAGTGTGTAGGGGG - Intronic
1123777929 15:23598963-23598985 CTGGATTTCCAGCTTGCAGAAGG - Intronic
1124356566 15:28999838-28999860 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1124384292 15:29193568-29193590 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1124610376 15:31203921-31203943 CAGGGTCTCCAGCATGTCGATGG - Intergenic
1124676031 15:31686556-31686578 CTGGATCTGCTCCTTGGAGATGG - Intronic
1125578547 15:40770533-40770555 CAGGCTCAGCTGCTTGAAGAAGG - Exonic
1127113748 15:55702894-55702916 CTGGATCAGCAGCCTGTAAAAGG - Intronic
1128020471 15:64385951-64385973 CAGGGTCTCCTGCTTGCAGATGG + Intronic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1129281364 15:74487772-74487794 CAGGGTCTCCAGCTTGCATATGG - Intergenic
1130081998 15:80742212-80742234 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1131571416 15:93541051-93541073 CAGGATCTGGAGCTTCTTGAAGG - Intergenic
1132152395 15:99471724-99471746 CTGGGTCTTCAGCTTGCAGATGG + Intergenic
1132512343 16:350214-350236 CAACATCAGTAGCTTGTAGAGGG - Intronic
1135217617 16:20586339-20586361 CTGGATCTCCAGCATGCAGATGG + Intergenic
1135253654 16:20922853-20922875 CTGGGTCTCCAGCTTGCAGACGG - Intronic
1135681378 16:24460229-24460251 CTGGCTCCTCAGCTTGTAGACGG - Intergenic
1136625281 16:31458587-31458609 CAGGTTTTGGGGCTTGTAGACGG + Intronic
1136636142 16:31524434-31524456 CAGGACCTGCAGCCTCCAGAGGG - Intergenic
1137727085 16:50664206-50664228 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1138719381 16:59061149-59061171 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1139044117 16:63035494-63035516 CTGGTTCTCCAGCTTGCAGAAGG + Intergenic
1139063259 16:63281660-63281682 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1139703934 16:68727301-68727323 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
1140626705 16:76803444-76803466 TAGGATGGGCAGGTTGTAGATGG + Intergenic
1140643148 16:77000699-77000721 GAGGACCTGCTGCTTGCAGATGG + Intergenic
1141536236 16:84682294-84682316 CTGGCTCTCCAGCTTGCAGAGGG + Intergenic
1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG + Intronic
1144060516 17:11580040-11580062 CCAGATCTTCAGCTTGCAGAGGG - Intergenic
1144269851 17:13605255-13605277 CAGGGTCCGCAGCTTGCAAATGG - Intergenic
1144324180 17:14161825-14161847 TAGGGTCTCCAGCTTGCAGATGG + Intronic
1144950767 17:18992301-18992323 CAGAAACTGCAGCTGGGAGAGGG + Intronic
1145284667 17:21496282-21496304 CAGGAATTGCAGCCTGGAGAGGG + Intergenic
1146624819 17:34427203-34427225 CAGAATAAGCAGCTGGTAGATGG + Intergenic
1146831499 17:36073219-36073241 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1147701743 17:42400468-42400490 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1147901060 17:43785139-43785161 CAGGGTCTCCAGCTTGCAGATGG - Exonic
1148536737 17:48445323-48445345 CATGATATGCAGCTAGGAGATGG + Intergenic
1148629439 17:49095469-49095491 CAGGGCCTCCAGCTTGCAGACGG + Intergenic
1149086553 17:52724378-52724400 TAGGGTCTCCAGCTTGTAGAAGG + Intergenic
1149399507 17:56280553-56280575 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1149645686 17:58239891-58239913 CAGCATCTGGAGGTTGCAGAGGG - Intronic
1152407303 17:80104987-80105009 CAGGTTCTCCAGCTTGTAGCTGG - Intergenic
1152425263 17:80215067-80215089 CAGGCTCCGCACCTTGTCGAAGG + Exonic
1153274991 18:3359705-3359727 CACATTCTCCAGCTTGTAGATGG - Intergenic
1153432275 18:5030846-5030868 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1155106623 18:22673263-22673285 CTGGTTCTCTAGCTTGTAGAAGG - Intergenic
1155531416 18:26770799-26770821 CTGGATCTCCAACTTGCAGAAGG - Intergenic
1155618278 18:27746333-27746355 CTGGTTCTGCAGCTTGCAGACGG + Intergenic
1155802340 18:30123332-30123354 CAGGATCTCTGGCTTGCAGATGG + Intergenic
1156119207 18:33821225-33821247 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1156329353 18:36104832-36104854 CAGGGTCTCCAGCTTGCAGACGG + Intergenic
1156491022 18:37496122-37496144 GAGGAGCTGCAGCTTGAACACGG - Intronic
1156659018 18:39323642-39323664 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1157055263 18:44220645-44220667 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1157444421 18:47734029-47734051 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1157540694 18:48503626-48503648 CTGGCTCTCCAGCTTGCAGATGG - Intergenic
1157690658 18:49679318-49679340 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1157896273 18:51471145-51471167 ACGGTTCTGCAGCTTGCAGATGG + Intergenic
1158323169 18:56285430-56285452 CACGGTCTCCAGCTTGCAGACGG + Intergenic
1158758199 18:60351771-60351793 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1159280329 18:66276677-66276699 CAGGTGCTTCAGCTTGCAGATGG - Intergenic
1159460676 18:68719332-68719354 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1160073898 18:75653622-75653644 CAGGTGCTGCAGCATGTTGACGG - Intergenic
1162880098 19:13652353-13652375 CTGGATCTCCAGCTTGGAGATGG - Intergenic
1164564802 19:29318167-29318189 CTGGATCTGGAGTTTGTACAAGG - Intergenic
1164880559 19:31729187-31729209 CTGGGTCTCCAGCTTGCAGAGGG + Intergenic
1165920476 19:39294667-39294689 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1166477195 19:43137647-43137669 CTGGATCCTCAGCTTGCAGATGG + Intronic
1166746021 19:45142238-45142260 CAGGATGTGCAGCCTGTTGGGGG + Intronic
1166864213 19:45826275-45826297 CAGGAGCTGCAGGTAGTTGAGGG + Exonic
1168208535 19:54871106-54871128 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1168529125 19:57113205-57113227 CAGGCTCCTCAGCTTGCAGACGG + Intergenic
925729972 2:6912772-6912794 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
925770607 2:7279005-7279027 CTGGCTCTCCAGCTTGTAGAGGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
925907884 2:8550307-8550329 AAGGTTGTGCAGCTTGTAAATGG + Intergenic
930272630 2:49274567-49274589 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
931195947 2:60052493-60052515 CTGGTTCTCCAGCTTGTAGAAGG - Intergenic
931209301 2:60177492-60177514 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
931686976 2:64802454-64802476 CTGGGTCTGCAACTTGCAGATGG - Intergenic
931694045 2:64859064-64859086 CAGTATTTGTAGCCTGTAGAAGG + Intergenic
932943776 2:76202950-76202972 CAGGGTCTCCAGCTTAGAGATGG - Intergenic
933310484 2:80654542-80654564 CCGGGTCTCCAGCTTGCAGATGG + Intergenic
933426914 2:82125696-82125718 CTGGCTCTCCAGCTTGTAGACGG - Intergenic
934102343 2:88665097-88665119 CAGGATATGAAGTTTGGAGAGGG + Intergenic
934578618 2:95419923-95419945 CCGGTTCTCCAGCTTGCAGATGG - Intergenic
934600823 2:95656786-95656808 CCGGTTCTTCAGCTTGCAGATGG + Intergenic
934609489 2:95724095-95724117 CAGGGACTGCAGCTTGTATTAGG - Intergenic
935328051 2:101955795-101955817 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
935470707 2:103456359-103456381 CAGCATCTTCAGCTTGTGGATGG + Intergenic
936344985 2:111668739-111668761 CTGGGTCTCCAGCTTGTTGATGG - Intergenic
936494256 2:113004452-113004474 CAGGGTCTCCAGCTTGCAGGTGG - Intergenic
936534200 2:113298924-113298946 CCGGTTCTCCAGCTTGCAGATGG + Intergenic
936542815 2:113365673-113365695 CAGGAACTGCAGCTTCTATTAGG - Intergenic
936646023 2:114374120-114374142 TAGGGTCTCCAGCTTGCAGATGG - Intergenic
936651660 2:114434379-114434401 ACAGATCTGCAGCTTGTAGCTGG + Intergenic
936672058 2:114668167-114668189 CTGTTTCTTCAGCTTGTAGATGG - Intronic
938070143 2:128304121-128304143 CTGGTTCTCCAGCTTGCAGATGG + Intronic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
938982568 2:136540420-136540442 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
939875612 2:147574028-147574050 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
939948395 2:148438690-148438712 CAGGATCTCCAGCTTGCAGATGG - Intronic
941416831 2:165231502-165231524 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
941524069 2:166584213-166584235 CAGAATCTGCGGTGTGTAGAGGG + Intergenic
942320535 2:174732147-174732169 CTAGCTCTGCAGCTTGGAGATGG - Intergenic
942872610 2:180753527-180753549 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
942988227 2:182166598-182166620 CTGGCTCTCCAGCTTGCAGATGG + Intronic
943240010 2:185371245-185371267 CTGGTTCTCCAGCTTGTACATGG + Intergenic
943261219 2:185665964-185665986 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
943618806 2:190124123-190124145 CAGGGTCTCCAGATTGCAGATGG + Intronic
944280024 2:197885266-197885288 TTGGGTCTCCAGCTTGTAGATGG - Intronic
944936384 2:204573393-204573415 TAGGCTCTGCAGCTGGTAGTGGG + Intronic
945171271 2:206998043-206998065 CTGGATCTCTAGCTTGCAGATGG + Intergenic
945414636 2:209555873-209555895 CAGCATCTGCAGTTTGTAACAGG + Intronic
946424311 2:219584596-219584618 CAGGAACTGCACCTTGTGGGAGG + Intergenic
946565693 2:220962184-220962206 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
947076029 2:226346946-226346968 CAGTTTCTCCAGCTTGCAGATGG + Intergenic
947920018 2:233862310-233862332 CTGGACCTCCAGCTTGCAGACGG - Intergenic
948276360 2:236712112-236712134 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
948997183 2:241587483-241587505 CAGGGTTTCCAGCTTGTGGAGGG + Intronic
949014783 2:241702803-241702825 CAGGGTCTCCCGCTCGTAGAGGG + Intronic
1169368469 20:5010188-5010210 CAGGTTCCCCAGCTTGCAGACGG - Exonic
1170428129 20:16255899-16255921 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1170674854 20:18469482-18469504 CTGGGTCTCCAGCTTGCAGAGGG + Intronic
1172452868 20:35040570-35040592 CAGGTTCTCCAGCTTGCAGACGG + Intronic
1172853003 20:37980078-37980100 CGTGATCTGCAGGCTGTAGAAGG - Intergenic
1173281332 20:41631045-41631067 CTGGTTCTACAGCTTGCAGATGG + Intergenic
1173406208 20:42767453-42767475 CTGGATCTCCAGCTCGCAGATGG + Intronic
1174524697 20:51161563-51161585 CTGGATCTCCAGCTTGCAGAGGG + Intergenic
1175169118 20:57067601-57067623 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1175663784 20:60840644-60840666 CTGGATCTCCAGCTTGCAAAGGG + Intergenic
1177062059 21:16388442-16388464 CAGGATCTCCAGCTTGCAGGTGG - Intergenic
1177197341 21:17917329-17917351 CTGGTTCTCCAGCTTGAAGATGG + Intronic
1177296414 21:19181887-19181909 CTGATTCTTCAGCTTGTAGATGG + Intergenic
1178110956 21:29369852-29369874 CTGGGTCTGCAGCTTGCAGATGG + Intronic
1178803711 21:35820562-35820584 CTGGGTCTCCAGCTTGCAGAAGG + Intronic
1179433222 21:41339902-41339924 CAAGGTCTCCAGCTTGCAGATGG - Intronic
1180588851 22:16918508-16918530 CAGGACCTGCAGCTTCACGAAGG - Intergenic
1180620420 22:17158475-17158497 CAGGTCCTGCAGCTGGGAGACGG - Intronic
1180728275 22:17962184-17962206 CAGGATCTTTAGCTTCTGGAGGG - Intronic
1181385453 22:22542055-22542077 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1182191774 22:28468595-28468617 CGGGAGCTGCAGCTTGCAGTGGG - Intronic
1183981185 22:41541361-41541383 CAGGGACTGCAGCTGGCAGAGGG + Intronic
1184032382 22:41902699-41902721 CAGGGACAGCAGCTTGTATAGGG - Intronic
1184292039 22:43502550-43502572 CAGCTTCTGCAGCCTGGAGAAGG - Intronic
1185201557 22:49509164-49509186 CAGGGTATCCAGCTTGCAGACGG - Intronic
1185249235 22:49791086-49791108 ACGGATCTGCAGCTGGCAGAGGG - Intronic
949264293 3:2138767-2138789 CTGGATCTCCAGCTTATAGATGG + Intronic
949585362 3:5431668-5431690 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
949949274 3:9215905-9215927 CTGGATCTCCAGCTTGTAGATGG + Intronic
950480781 3:13242521-13242543 CGGGATGTGCAGCTAGTGGAAGG - Intergenic
950807650 3:15620906-15620928 CAGGGTCTCCAGCTTGCAGATGG - Intronic
951304991 3:21048618-21048640 CAGGAAATGCAGCTTTTAGATGG - Intergenic
952004128 3:28822708-28822730 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
952419401 3:33117820-33117842 CAGGCTCTGCAGCTGGAACATGG - Intronic
952562050 3:34606022-34606044 CAGGATCTCCAGTTTGCAGATGG + Intergenic
952886029 3:38011374-38011396 CTGGGTCAGCATCTTGTAGAAGG + Exonic
952957349 3:38565393-38565415 CAGGATCTGCAGACTGAAAAGGG - Intronic
953081697 3:39625716-39625738 CAGCATCTGGAGCTTGGTGAGGG - Intergenic
953166214 3:40467302-40467324 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
953397409 3:42584030-42584052 CTGGTTCTCCAGCTTGTAGATGG + Intronic
953826597 3:46257786-46257808 CAGGGTCTCCAGCTTGTAGATGG - Intronic
954256758 3:49412536-49412558 CAGCAGCAGCAGCTTGAAGAGGG - Exonic
955644286 3:61119914-61119936 CTGAATCTCCAGCTTGCAGACGG + Intronic
955868212 3:63408450-63408472 CTGGTTCTCCAGCTTGCAGATGG - Intronic
956852022 3:73237660-73237682 CTGGGTCTGGAGCTTGCAGATGG - Intergenic
957326760 3:78705860-78705882 CTGGTTCTTCACCTTGTAGATGG + Intronic
958414903 3:93862213-93862235 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
958710528 3:97711480-97711502 CTGGTTCTCCAGCTTGCAGATGG - Intronic
958830311 3:99079366-99079388 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
959017736 3:101154831-101154853 CAGGGTCTCCAGCTGGCAGATGG - Intergenic
959769867 3:110080662-110080684 CTGGTTCTACAGCTTGCAGATGG + Intergenic
961480782 3:127178588-127178610 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
962455119 3:135558050-135558072 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
962892459 3:139684324-139684346 CTGGCTCTCCAGCTTGCAGATGG - Intergenic
962929749 3:140025421-140025443 CAGGATGAGCAACTTGTGGAAGG - Intronic
962943070 3:140143281-140143303 CTGGTTCTCCAGCTTGCAGATGG - Intronic
964402299 3:156311910-156311932 CAGGCTCTGCAGCCTGTTGACGG + Intronic
964625234 3:158752289-158752311 CTGGATCTCCAGCTTGCAGATGG + Intronic
965627261 3:170693864-170693886 CTGGTTCTCCAGCTTGCAGATGG + Intronic
965914580 3:173827737-173827759 CTGGTTCTCCAGCTTGCAGATGG - Intronic
966221616 3:177557123-177557145 CTTGATCCTCAGCTTGTAGATGG + Intergenic
966394687 3:179490513-179490535 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
966420851 3:179732874-179732896 CAGGGTCTGAGGCTTGTAGGTGG + Intronic
966485045 3:180459477-180459499 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
966497295 3:180595715-180595737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
966646124 3:182247921-182247943 TAGGAGCTGCAGCCGGTAGATGG + Intergenic
966859785 3:184224255-184224277 CAGGGTCTCCAGCTTGCAGAGGG - Intronic
967184355 3:186931962-186931984 CACGATCTGCAGCGGGGAGATGG + Intronic
967890427 3:194360696-194360718 CAGAACCTGCAGCTTGTTGTTGG + Exonic
968188598 3:196650996-196651018 CAGCATCTGCAGCTGTAAGAGGG - Intronic
968354031 3:198087615-198087637 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
968360939 3:198146392-198146414 CTGGTTCTCCAGCTTGTAGATGG - Intergenic
968401130 4:298704-298726 CAGGATCTGCAGCTTCACCAGGG - Intronic
968432645 4:567789-567811 CAGGCTCTGCAGCTTGGTAAAGG - Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
969066107 4:4482589-4482611 CAGGAACAGAAGCTGGTAGATGG - Intronic
969861123 4:10036015-10036037 CAGGGTCTCCAGCTTGCAGATGG + Intronic
969887844 4:10232103-10232125 CAGGTACTCCAGCTTGTAAATGG - Intergenic
969983861 4:11186949-11186971 CATGCTCTTCAGCTTGCAGAAGG + Intergenic
970249579 4:14100076-14100098 CTGGGTCTCCAGCTTGTAGAAGG + Intergenic
970701108 4:18739718-18739740 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
970955766 4:21809406-21809428 CAGGTTCTCCAGCTTGCAGATGG + Intronic
971060918 4:22968484-22968506 CAGGATCTTCATCTTTAAGATGG - Intergenic
971355160 4:25888636-25888658 AAGGATCAGGAGCTTGAAGAGGG - Intronic
972667168 4:41177648-41177670 CAGGCTGTGCAGCTAGTAGGTGG - Intronic
973631882 4:52827174-52827196 CAGGGTCTTCAGCTTACAGATGG + Intergenic
974212041 4:58790670-58790692 CTGGGTATCCAGCTTGTAGATGG + Intergenic
974274460 4:59699859-59699881 CAGGATCTGCATCTTGAAAGAGG - Intergenic
974512843 4:62867116-62867138 CTGGATCTGTAGCTTCCAGAAGG + Intergenic
974625082 4:64415956-64415978 CAGGGTCTCCAGCTCGCAGATGG - Intergenic
974737181 4:65952026-65952048 CAGGGTCTGAAGCTTGCATACGG - Intergenic
974847752 4:67371524-67371546 CTGGATCTCCAGCTTGCAGAGGG - Intergenic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
975634033 4:76428171-76428193 CTGGGTCATCAGCTTGTAGAGGG - Intergenic
975742078 4:77439120-77439142 CAGGGTCTCCACCTTGCAGATGG + Intergenic
975746510 4:77480589-77480611 TAGTATCTCCAGCTTGCAGATGG + Intergenic
975764119 4:77649394-77649416 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
976194232 4:82517736-82517758 CAGGGTCTCCATCTTGCAGATGG + Intronic
976431869 4:84971816-84971838 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
976542369 4:86293623-86293645 ATGGTTCTGCAGCTTGTACAGGG + Intronic
976598799 4:86918908-86918930 CAGGGTCTCCAGCTTGCAGATGG - Intronic
976808903 4:89078918-89078940 CTGGACCTGCAGCTTATAGATGG - Intronic
977363551 4:96037032-96037054 CTGGATCTCCAGCTTGCACATGG + Intergenic
977604023 4:98964106-98964128 CAGGCTCTGCAGCATCTATAGGG + Intergenic
977985021 4:103373035-103373057 CAGGGTCTCCAGCTTGCAAATGG - Intergenic
978495906 4:109358769-109358791 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
978579003 4:110213994-110214016 CTGGGTCTCCAGCTTGTAGATGG - Intergenic
978613152 4:110566596-110566618 TGGGATCTCCAGCTTGCAGATGG - Intergenic
979027129 4:115591991-115592013 CAGGGTCTCCAGCTTGTAGATGG - Intergenic
979919237 4:126477909-126477931 CTGGGTCTGCAGCTTGCACACGG + Intergenic
980225138 4:129973889-129973911 CTGGATCTTCAGCTTGCAGATGG - Intergenic
980431801 4:132709871-132709893 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
980568438 4:134577295-134577317 CTGGTTCTCCAGCATGTAGATGG + Intergenic
980678680 4:136126156-136126178 CTGGATCCTCAGCTTGTAGATGG - Intergenic
980807532 4:137833093-137833115 CTGGTTCTTCAGCTTGTAGATGG - Intergenic
980828897 4:138105726-138105748 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
981297263 4:143146640-143146662 CAGGCTTTTCAGCTTGAAGATGG - Intergenic
981567146 4:146113670-146113692 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
981835695 4:149050899-149050921 CAGGCTCTGCTGGTTGTAGAGGG - Intergenic
981953977 4:150447551-150447573 CAGGGTCTCCAGCCTGCAGATGG + Intronic
982055647 4:151546372-151546394 CAAGGTCTCCAGCTTGCAGATGG + Intronic
982352649 4:154432886-154432908 CAGGGCCTTCAGCTTCTAGAGGG + Intronic
982402792 4:154986397-154986419 CAGGGTCTCCAGCTTGCTGATGG + Intergenic
982456013 4:155610370-155610392 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
984590888 4:181616616-181616638 CTGGTTCTCCAGCTTGCAGACGG - Intergenic
984848691 4:184131902-184131924 CTAGATCTCCAGCTTGTGGATGG - Intronic
985051349 4:185995458-185995480 CTGGTTCTCCAGCTTGCAGAGGG - Intergenic
986149161 5:5111021-5111043 CAGGATCTCCAGCTTACAGATGG + Intergenic
987546323 5:19314846-19314868 TAGGGTCTGCAACTTGCAGACGG - Intergenic
988528300 5:32005738-32005760 CAGGACATGCAGCTTTTAAAGGG - Intronic
988582709 5:32482120-32482142 CAGGGTCCCCAGCTTGCAGATGG + Intergenic
989000608 5:36756506-36756528 CATGATCTCCAAGTTGTAGATGG - Intergenic
989283050 5:39666869-39666891 CAGGTTCTCTAGCTTGAAGATGG - Intergenic
989451958 5:41597244-41597266 CTGGGTATCCAGCTTGTAGATGG - Intergenic
989503798 5:42202017-42202039 CTGGTTCTCTAGCTTGTAGATGG - Intergenic
989699295 5:44242897-44242919 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
990282968 5:54271175-54271197 CATGGTCTCCAGCTTGCAGATGG + Intronic
990559390 5:56968254-56968276 CTGGTTCTCCAGCTTGCAGATGG + Intronic
990680837 5:58242524-58242546 CAGGATCTGCAGGTTTTATAAGG - Intergenic
991108997 5:62876346-62876368 CTGGGTCTCCAGCTTGCAGACGG + Intergenic
991303379 5:65150405-65150427 CAGGATGTGAAACTTGAAGATGG + Exonic
991498639 5:67253269-67253291 CAGCATCTCCCGCTAGTAGAGGG - Intergenic
992103153 5:73426670-73426692 CAGGGTCTCCAGCTTTTGGACGG + Intergenic
992376964 5:76197801-76197823 CAGCATTTCCAGCTTGCAGAAGG - Intronic
992595582 5:78344094-78344116 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
994440456 5:99796626-99796648 CAGTGTCTCCAGCTTGCAGATGG + Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995412927 5:111878804-111878826 GAGCATCTGAAGCTTGCAGATGG - Intronic
996511245 5:124318667-124318689 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
996916100 5:128713857-128713879 CAGGATCTCCAGCTACTACATGG + Intronic
997768754 5:136532352-136532374 CAGGGTCTCCAGCTTATAGATGG + Intergenic
997777892 5:136627818-136627840 CTGGTTCTGCAGCTTGCAGATGG + Intergenic
998711876 5:144835204-144835226 TTGGATCTCCAGCTTGCAGATGG - Intergenic
998725213 5:145004861-145004883 CTGGTTCTCCAGCTTGAAGATGG - Intergenic
999146273 5:149397739-149397761 CAGGGTCTCCAGCTTGTAGACGG - Intronic
999877399 5:155823213-155823235 CTGGGTCTCCAGCTTGGAGAAGG - Intergenic
1000423324 5:161062145-161062167 CAGGGTTTTCAGCTTGGAGATGG - Intergenic
1000743702 5:165003245-165003267 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1000986840 5:167869736-167869758 CTGCATGTGCAGCTTTTAGAGGG - Intronic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1001538902 5:172523242-172523264 CTGGCTTGGCAGCTTGTAGAAGG + Intergenic
1001945639 5:175775315-175775337 CAGGATCTGGAGCATCTGGATGG - Intergenic
1002382264 5:178839324-178839346 GGGAATCTGCAGCTTGCAGAGGG - Intergenic
1002648372 5:180673670-180673692 GGGAATCTGCAGCTTGCAGAGGG + Intergenic
1004199208 6:13532433-13532455 CAGGCTCTGCAGCTCCCAGAAGG + Intergenic
1004691948 6:17999728-17999750 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1004835961 6:19531794-19531816 CAGGGTTTCCAGCTTGTAGATGG + Intergenic
1005506203 6:26470866-26470888 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1007281813 6:40718528-40718550 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1007549981 6:42721849-42721871 CTCGATCTGCAGCATGTCGATGG + Exonic
1008234487 6:49027192-49027214 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1009034110 6:58095885-58095907 CTGGTTCTCCAGCTTGAAGAAGG - Intergenic
1009845247 6:69126353-69126375 CTGGTTCTCTAGCTTGTAGATGG - Intronic
1010003036 6:70967370-70967392 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1010049365 6:71484798-71484820 CTGAGTCTTCAGCTTGTAGATGG - Intergenic
1010614821 6:77999834-77999856 CAGGGCCTTCAGCTTGCAGATGG + Intergenic
1010736651 6:79450992-79451014 CAGGACCTGCAGCATCTAGTTGG - Intergenic
1010870486 6:81031288-81031310 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1011843118 6:91526835-91526857 CAGGCTATGCAGCTTGTAAATGG - Intergenic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1012422628 6:99081314-99081336 CAGGTTCTGCAGCTTGCAGATGG - Intergenic
1012471579 6:99578485-99578507 CTGGATCTCCAGCTTGAAGATGG - Intergenic
1013949665 6:115764590-115764612 GTGGTTCTCCAGCTTGTAGACGG + Intergenic
1014136081 6:117891528-117891550 CTGGGTATCCAGCTTGTAGATGG + Intergenic
1014330338 6:120055962-120055984 CAGGCTCTGGAGCTGGTAGGAGG + Intergenic
1016158971 6:140852357-140852379 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
1016562811 6:145416042-145416064 CATGATCTGCAGCTGGGAGTCGG - Intergenic
1016595015 6:145789089-145789111 CTGGCTCTCCAGCTTGCAGATGG + Intergenic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1018116818 6:160594453-160594475 CAGGCTGTGCAGGTTGTAGGTGG + Intronic
1018225101 6:161621285-161621307 CAGGGTCTTCAGCTTGTAGATGG - Intronic
1018589802 6:165407022-165407044 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1019259070 7:70262-70284 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
1019975944 7:4581679-4581701 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1020056041 7:5118008-5118030 CCGGTTCCGCAGCGTGTAGATGG - Intergenic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1020961048 7:14801723-14801745 CTGGATCGCCAGCTTGTAGAAGG + Intronic
1022106584 7:27201253-27201275 TAGGATCTCCAGCCTGCAGAGGG + Intergenic
1022316400 7:29249151-29249173 CAGAGTCTCCAGCTTGCAGATGG - Intronic
1023194428 7:37618446-37618468 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1023661099 7:42471671-42471693 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1023972202 7:44999979-45000001 CAGGATCTTCAGCCTGTGGGCGG + Intronic
1024207721 7:47178072-47178094 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1024492318 7:49999521-49999543 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1025923501 7:65937326-65937348 CAGGAAGAGCAGCTTGTAGTGGG + Intronic
1026391311 7:69905420-69905442 CAGGGTCTCCATCTTGCAGATGG - Intronic
1027685395 7:81274104-81274126 CAGGATATGCAGCCTGGAGTCGG + Intergenic
1027830219 7:83167330-83167352 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027879983 7:83822344-83822366 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027957705 7:84902593-84902615 CAGAATCTCCAGCTTGCAGATGG + Intergenic
1028068643 7:86420846-86420868 CTGGATCTCTAGCTTGCAGAGGG + Intergenic
1028472936 7:91224246-91224268 CCCTATCTGCAGTTTGTAGAGGG - Intergenic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1029862060 7:103583253-103583275 CAGGGTCTCCAACTTGCAGATGG + Intronic
1030243840 7:107359834-107359856 CAGGATGACCAGCTTGCAGATGG + Intronic
1030550232 7:110949108-110949130 CAGGGTCTCCAGCTTGCAGGTGG + Intronic
1030677093 7:112395293-112395315 CTGCATCTTCACCTTGTAGAGGG + Intergenic
1030841018 7:114354285-114354307 CTGGTTCTTCAGCTTGCAGATGG + Intronic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1033379295 7:140798334-140798356 CAGGAGGTGGAGCTTGTAGCGGG - Intronic
1034072485 7:148199844-148199866 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1034523586 7:151639788-151639810 CAGGGACTCCAGCTTGGAGATGG + Intronic
1034647882 7:152664660-152664682 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1034890303 7:154833529-154833551 CAGGACCTGTTGCTGGTAGACGG + Intronic
1035642810 8:1196943-1196965 CTGGGTCTCCAGCTTGTGGATGG - Intergenic
1037260429 8:17001793-17001815 CAGGATCTGCAGGTGGAAGCCGG + Exonic
1037544492 8:19905640-19905662 CTGGTTCTACAGCTTGTAAATGG - Intronic
1037545901 8:19922001-19922023 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1037670460 8:21011237-21011259 CTGGACCTCCAGCTTGCAGATGG - Intergenic
1037685105 8:21131794-21131816 GTGGGTCTGCAGCTTGCAGATGG + Intergenic
1038393708 8:27230950-27230972 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1038397317 8:27256924-27256946 CAGGATCTGCAAGTGCTAGATGG - Intronic
1038660480 8:29492672-29492694 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1039055442 8:33532712-33532734 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1039526742 8:38223740-38223762 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1039575523 8:38620689-38620711 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1040335382 8:46413374-46413396 GAGGATCTGTATCTTGTGGAAGG + Intergenic
1040623200 8:49113006-49113028 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1040646586 8:49403840-49403862 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1040828015 8:51645038-51645060 CTGGGTCTTCAGCTTGCAGAGGG - Intronic
1040998940 8:53430574-53430596 CTGGACCTCCAGCTTGCAGAGGG + Intergenic
1042492510 8:69416226-69416248 CAGGGTCTCCAGCTTACAGATGG - Intergenic
1042626558 8:70764368-70764390 CTGGAACTTCAGCTTGGAGAGGG + Intronic
1042840972 8:73123536-73123558 CTGGCTCTTCAGCTTGCAGATGG - Intronic
1043293463 8:78634554-78634576 CTGGATCTCCAGGTTGCAGAGGG - Intergenic
1043356806 8:79423211-79423233 CTGGTTCCGCAGCTTGCAGATGG + Intergenic
1043974910 8:86573662-86573684 CAGGGACTCCAGTTTGTAGATGG - Intronic
1044082712 8:87904837-87904859 TTGGGTCTCCAGCTTGTAGACGG - Intergenic
1044300874 8:90581510-90581532 CCAGATCTGCAGCTTTTAAAGGG + Intergenic
1044556040 8:93563157-93563179 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1044740216 8:95318667-95318689 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1045235598 8:100350383-100350405 CGGGTTCTCCAGCTTGCAGATGG + Intronic
1045826622 8:106405284-106405306 CTGGATTTGCACCTTGTGGATGG - Intronic
1046025179 8:108713784-108713806 CAGGGTCTCCAGCTTGCAGATGG - Intronic
1046035810 8:108840141-108840163 CTGGGTCTCCAGCTTGGAGATGG - Intergenic
1046795373 8:118365621-118365643 CCGGTTCTTCCGCTTGTAGATGG + Intronic
1047238318 8:123061941-123061963 CAAGTTCTTCAGCTTGTAGATGG + Intronic
1048106366 8:131414827-131414849 CAGGACCTCTAGCTTGTATATGG - Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048598904 8:135897633-135897655 TTGGATCTTCAGCTTGCAGATGG - Intergenic
1048970846 8:139644185-139644207 CAGTGTCCGCAGCTTGTAGGAGG + Intronic
1049101595 8:140583275-140583297 CAGGGTCTCCAGCTTGTAAATGG + Intronic
1049268674 8:141682825-141682847 CAGGAGATGCAGCTTGTGAAGGG + Intergenic
1049995924 9:1033601-1033623 CAGGATCTGAATCCTGTATAAGG - Intergenic
1050027425 9:1350396-1350418 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1050045958 9:1545422-1545444 CTTGATCCTCAGCTTGTAGATGG - Intergenic
1050978182 9:11968940-11968962 CTGGCTCTCCAGCTTGCAGATGG + Intergenic
1051333956 9:16049704-16049726 CCGGGTCTCCAGCTTGCAGATGG + Intronic
1051832306 9:21293402-21293424 CAGGGTCTCCAGCTTACAGATGG + Intergenic
1052078940 9:24179686-24179708 CAAGATCTGAAGCTTTTATAAGG - Intergenic
1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG + Intronic
1052939869 9:34124772-34124794 CTGGATGTGCTGCTTCTAGAGGG - Intronic
1056009918 9:82317173-82317195 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056462875 9:86825197-86825219 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1056525656 9:87440723-87440745 CAGGGTCTGCAGCTTGCAGATGG - Intergenic
1056872217 9:90292414-90292436 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057130017 9:92648592-92648614 CAGAGGCTGCAGCTTTTAGAGGG - Intronic
1057145636 9:92757356-92757378 CAGGATCTGCAGGTTGCATTTGG - Intronic
1057498659 9:95579672-95579694 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057586058 9:96329959-96329981 CAGGGTCTCCAACTTGCAGATGG - Intronic
1057735358 9:97653471-97653493 CAGGATGTACAGCTTTTTGAGGG - Intronic
1057941131 9:99285974-99285996 CTGGTTCTCCAACTTGTAGATGG - Intergenic
1058340200 9:103886100-103886122 CAGGGTCTCCAGCTTGCAGATGG + Intergenic
1058732908 9:107867659-107867681 CAGGATGTGCAGCATATATAGGG - Intergenic
1058919606 9:109600332-109600354 CAGGAGCTGCAGCCTGCAGTAGG - Intergenic
1060017025 9:120095707-120095729 CTGGGCCTCCAGCTTGTAGATGG - Intergenic
1060123102 9:121014466-121014488 TAGGATATTCAGCTTGAAGAAGG - Intronic
1062745647 9:138210223-138210245 CTGGTTCTCCAGCTTGTAGACGG - Intergenic
1186187250 X:7033249-7033271 CTGGATCCTCAGCTTGCAGATGG + Intergenic
1186491584 X:9977755-9977777 CAAGGTCTCCAGCTTGCAGACGG - Intergenic
1186658610 X:11644262-11644284 TAGCATCTGGAGCTTGAAGATGG - Intronic
1186942171 X:14521565-14521587 CAGGGTGTCCAGCTTGCAGATGG + Intergenic
1187060169 X:15779107-15779129 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1187334968 X:18373960-18373982 CCGGAACTGCAGCTACTAGATGG + Intergenic
1187462098 X:19496596-19496618 CAGGGTCTGCAGCGTGTGGCTGG - Intronic
1187597665 X:20791667-20791689 TTGGATCTGCAGCTTGCAAATGG + Intergenic
1187961025 X:24566427-24566449 CATGATCTCAAGTTTGTAGAAGG + Intronic
1189567791 X:42261332-42261354 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1189665788 X:43353366-43353388 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1189728211 X:43990189-43990211 CAGGGTCTGCAGCTTGCAGACGG + Intergenic
1189728386 X:43992735-43992757 CAGGGTCTGCAGCTTGCAGACGG - Intergenic
1190507097 X:51137083-51137105 CAGGGTCTCCAGCCTGCAGATGG - Intergenic
1190626787 X:52344633-52344655 TTGGCTCTCCAGCTTGTAGACGG + Intergenic
1190701217 X:52991196-52991218 CTGGCTCTCCAGCTTGCAGATGG - Intronic
1191630607 X:63317678-63317700 CAGGAACTCCAACTTGCAGATGG + Intergenic
1191631597 X:63327669-63327691 CAGGGTCTCCAGCTTGCAAATGG + Intergenic
1191933237 X:66396820-66396842 CTGGATCCACAGCTTGCAGATGG + Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1192609177 X:72550639-72550661 CAGGGACTGCAACTTGTTGATGG - Intronic
1192743928 X:73920001-73920023 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1193235407 X:79100615-79100637 TTGGGTCTCCAGCTTGTAGATGG + Intergenic
1193345596 X:80400030-80400052 CAGGATCTCCAGCTTGCAGAAGG - Intronic
1193376336 X:80766318-80766340 CTGGGTCTTCAGCTTGCAGATGG + Intronic
1194659915 X:96619190-96619212 CAGGGTCTTCAGCTTTCAGATGG + Intergenic
1194793670 X:98183072-98183094 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
1195353472 X:104016011-104016033 CAGGATCTGATGGTTTTAGAAGG - Intergenic
1196555272 X:117078073-117078095 CACGAGCTGCACCTTGTGGAAGG + Intergenic
1196894656 X:120323010-120323032 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1198708649 X:139477227-139477249 CGGGATCTCCAGCTTGCAGATGG + Intergenic
1198774985 X:140170056-140170078 AAGGATCTGAAGTTTGTAAATGG + Intergenic
1198851680 X:140970896-140970918 CAGGTTTTCCAGGTTGTAGAAGG - Intergenic
1199371422 X:147054335-147054357 CTAGATCTCCAGCTTGCAGATGG - Intergenic
1199436074 X:147814267-147814289 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1199572316 X:149279275-149279297 CTGGGTCTCCAGCTTGTAGATGG + Intergenic
1199610474 X:149608130-149608152 CAGGATGTGAAGCTGGGAGAAGG + Intronic
1200335126 X:155342448-155342470 TCGGTTCTGCAGCTTGCAGATGG - Intergenic
1200351342 X:155498773-155498795 TCGGTTCTGCAGCTTGCAGATGG + Intronic
1201437868 Y:13978961-13978983 CTGGCTCCTCAGCTTGTAGACGG - Intergenic