ID: 949823933

View in Genome Browser
Species Human (GRCh38)
Location 3:8144548-8144570
Sequence AAAGCATCCTAAAACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949823927_949823933 30 Left 949823927 3:8144495-8144517 CCTGCTCCCCTCCATCTATTCTA No data
Right 949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG No data
949823929_949823933 23 Left 949823929 3:8144502-8144524 CCCTCCATCTATTCTAAACAGAG No data
Right 949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG No data
949823930_949823933 22 Left 949823930 3:8144503-8144525 CCTCCATCTATTCTAAACAGAGT No data
Right 949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG No data
949823928_949823933 24 Left 949823928 3:8144501-8144523 CCCCTCCATCTATTCTAAACAGA No data
Right 949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG No data
949823931_949823933 19 Left 949823931 3:8144506-8144528 CCATCTATTCTAAACAGAGTGAT No data
Right 949823933 3:8144548-8144570 AAAGCATCCTAAAACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949823933 Original CRISPR AAAGCATCCTAAAACCTGTC AGG Intergenic
No off target data available for this crispr