ID: 949824522

View in Genome Browser
Species Human (GRCh38)
Location 3:8151500-8151522
Sequence GTATATAACAAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949824519_949824522 -1 Left 949824519 3:8151478-8151500 CCAACTATGTGGTTGGTTTTCAG No data
Right 949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949824522 Original CRISPR GTATATAACAAGAAGGAGGA AGG Intergenic
No off target data available for this crispr