ID: 949826845

View in Genome Browser
Species Human (GRCh38)
Location 3:8174565-8174587
Sequence ATGTAGCCAGAGTTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949826845_949826849 -10 Left 949826845 3:8174565-8174587 CCCACCTCCAACTCTGGCTACAT No data
Right 949826849 3:8174578-8174600 CTGGCTACATGTGACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949826845 Original CRISPR ATGTAGCCAGAGTTGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr