ID: 949828196

View in Genome Browser
Species Human (GRCh38)
Location 3:8185230-8185252
Sequence CAAACCAAATTGAATGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949828196_949828202 17 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG No data
949828196_949828200 10 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828200 3:8185263-8185285 AGCACTGTCAGGAGACCAGAGGG No data
949828196_949828199 9 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828199 3:8185262-8185284 AAGCACTGTCAGGAGACCAGAGG No data
949828196_949828201 14 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828201 3:8185267-8185289 CTGTCAGGAGACCAGAGGGCAGG No data
949828196_949828203 23 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828203 3:8185276-8185298 GACCAGAGGGCAGGAGGAAAAGG No data
949828196_949828198 -1 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828198 3:8185252-8185274 GGCTGAAGAAAAGCACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949828196 Original CRISPR CAAACCAAATTGAATGCCAG AGG (reversed) Intergenic
No off target data available for this crispr