ID: 949828198 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:8185252-8185274 |
| Sequence | GGCTGAAGAAAAGCACTGTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949828196_949828198 | -1 | Left | 949828196 | 3:8185230-8185252 | CCTCTGGCATTCAATTTGGTTTG | No data | ||
| Right | 949828198 | 3:8185252-8185274 | GGCTGAAGAAAAGCACTGTCAGG | No data | ||||
| 949828194_949828198 | 6 | Left | 949828194 | 3:8185223-8185245 | CCGTTGTCCTCTGGCATTCAATT | No data | ||
| Right | 949828198 | 3:8185252-8185274 | GGCTGAAGAAAAGCACTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949828198 | Original CRISPR | GGCTGAAGAAAAGCACTGTC AGG | Intergenic | ||
| No off target data available for this crispr | |||||