ID: 949828200

View in Genome Browser
Species Human (GRCh38)
Location 3:8185263-8185285
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949828196_949828200 10 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828200 3:8185263-8185285 AGCACTGTCAGGAGACCAGAGGG No data
949828194_949828200 17 Left 949828194 3:8185223-8185245 CCGTTGTCCTCTGGCATTCAATT No data
Right 949828200 3:8185263-8185285 AGCACTGTCAGGAGACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr