ID: 949828201

View in Genome Browser
Species Human (GRCh38)
Location 3:8185267-8185289
Sequence CTGTCAGGAGACCAGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949828194_949828201 21 Left 949828194 3:8185223-8185245 CCGTTGTCCTCTGGCATTCAATT No data
Right 949828201 3:8185267-8185289 CTGTCAGGAGACCAGAGGGCAGG No data
949828196_949828201 14 Left 949828196 3:8185230-8185252 CCTCTGGCATTCAATTTGGTTTG No data
Right 949828201 3:8185267-8185289 CTGTCAGGAGACCAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949828201 Original CRISPR CTGTCAGGAGACCAGAGGGC AGG Intergenic
No off target data available for this crispr