ID: 949829791

View in Genome Browser
Species Human (GRCh38)
Location 3:8201609-8201631
Sequence GGGCCTTATGGACCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949829788_949829791 -9 Left 949829788 3:8201595-8201617 CCCAGAAATGGCAAGGGCCTTAT No data
Right 949829791 3:8201609-8201631 GGGCCTTATGGACCCACTTCAGG No data
949829789_949829791 -10 Left 949829789 3:8201596-8201618 CCAGAAATGGCAAGGGCCTTATG No data
Right 949829791 3:8201609-8201631 GGGCCTTATGGACCCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949829791 Original CRISPR GGGCCTTATGGACCCACTTC AGG Intergenic
No off target data available for this crispr