ID: 949835147

View in Genome Browser
Species Human (GRCh38)
Location 3:8260207-8260229
Sequence AAACTCATACTGTCATACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949835145_949835147 14 Left 949835145 3:8260170-8260192 CCACATAGAGTTTTGCAGTATCC No data
Right 949835147 3:8260207-8260229 AAACTCATACTGTCATACTGAGG No data
949835146_949835147 -7 Left 949835146 3:8260191-8260213 CCTGATAACATCTCTTAAACTCA No data
Right 949835147 3:8260207-8260229 AAACTCATACTGTCATACTGAGG No data
949835143_949835147 19 Left 949835143 3:8260165-8260187 CCTTCCCACATAGAGTTTTGCAG No data
Right 949835147 3:8260207-8260229 AAACTCATACTGTCATACTGAGG No data
949835144_949835147 15 Left 949835144 3:8260169-8260191 CCCACATAGAGTTTTGCAGTATC No data
Right 949835147 3:8260207-8260229 AAACTCATACTGTCATACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949835147 Original CRISPR AAACTCATACTGTCATACTG AGG Intergenic
No off target data available for this crispr