ID: 949836851

View in Genome Browser
Species Human (GRCh38)
Location 3:8279263-8279285
Sequence GAAAAGAGGGAGACCGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949836840_949836851 20 Left 949836840 3:8279220-8279242 CCAGAAAAAGCCAGTAGCTATTG No data
Right 949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG No data
949836844_949836851 10 Left 949836844 3:8279230-8279252 CCAGTAGCTATTGGAATAGGGAT No data
Right 949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949836851 Original CRISPR GAAAAGAGGGAGACCGTGTA AGG Intergenic
No off target data available for this crispr