ID: 949837378

View in Genome Browser
Species Human (GRCh38)
Location 3:8283724-8283746
Sequence CTGTGTGGCTCTGTGACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949837378_949837385 29 Left 949837378 3:8283724-8283746 CCAGAAGTCACAGAGCCACACAG No data
Right 949837385 3:8283776-8283798 CCGGCTTTTTGCCCATTTGAAGG No data
949837378_949837382 10 Left 949837378 3:8283724-8283746 CCAGAAGTCACAGAGCCACACAG No data
Right 949837382 3:8283757-8283779 ATATTACACACCAGTATATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949837378 Original CRISPR CTGTGTGGCTCTGTGACTTC TGG (reversed) Intergenic