ID: 949837381 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:8283739-8283761 |
| Sequence | AATATGCCACTATGCCTGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949837381_949837385 | 14 | Left | 949837381 | 3:8283739-8283761 | CCACACAGGCATAGTGGCATATT | No data | ||
| Right | 949837385 | 3:8283776-8283798 | CCGGCTTTTTGCCCATTTGAAGG | No data | ||||
| 949837381_949837382 | -5 | Left | 949837381 | 3:8283739-8283761 | CCACACAGGCATAGTGGCATATT | No data | ||
| Right | 949837382 | 3:8283757-8283779 | ATATTACACACCAGTATATCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949837381 | Original CRISPR | AATATGCCACTATGCCTGTG TGG (reversed) | Intergenic | ||