ID: 949837385

View in Genome Browser
Species Human (GRCh38)
Location 3:8283776-8283798
Sequence CCGGCTTTTTGCCCATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949837378_949837385 29 Left 949837378 3:8283724-8283746 CCAGAAGTCACAGAGCCACACAG No data
Right 949837385 3:8283776-8283798 CCGGCTTTTTGCCCATTTGAAGG No data
949837381_949837385 14 Left 949837381 3:8283739-8283761 CCACACAGGCATAGTGGCATATT No data
Right 949837385 3:8283776-8283798 CCGGCTTTTTGCCCATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949837385 Original CRISPR CCGGCTTTTTGCCCATTTGA AGG Intergenic
No off target data available for this crispr