ID: 949837385 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:8283776-8283798 |
Sequence | CCGGCTTTTTGCCCATTTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949837381_949837385 | 14 | Left | 949837381 | 3:8283739-8283761 | CCACACAGGCATAGTGGCATATT | No data | ||
Right | 949837385 | 3:8283776-8283798 | CCGGCTTTTTGCCCATTTGAAGG | No data | ||||
949837378_949837385 | 29 | Left | 949837378 | 3:8283724-8283746 | CCAGAAGTCACAGAGCCACACAG | No data | ||
Right | 949837385 | 3:8283776-8283798 | CCGGCTTTTTGCCCATTTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949837385 | Original CRISPR | CCGGCTTTTTGCCCATTTGA AGG | Intergenic | ||