ID: 949843301

View in Genome Browser
Species Human (GRCh38)
Location 3:8343546-8343568
Sequence CTGGTGTTCTGGAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949843298_949843301 -1 Left 949843298 3:8343524-8343546 CCAAAATAATAAAAGAGAGAAGC No data
Right 949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949843301 Original CRISPR CTGGTGTTCTGGAAGAAAAA TGG Intergenic
No off target data available for this crispr