ID: 949846363

View in Genome Browser
Species Human (GRCh38)
Location 3:8374448-8374470
Sequence TGTCTAATATTGACAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949846363_949846369 13 Left 949846363 3:8374448-8374470 CCCCCCACTGTCAATATTAGACA No data
Right 949846369 3:8374484-8374506 GAAAATTAACAAGGATATTCAGG 0: 1178
1: 1730
2: 3445
3: 3619
4: 4353
949846363_949846368 4 Left 949846363 3:8374448-8374470 CCCCCCACTGTCAATATTAGACA No data
Right 949846368 3:8374475-8374497 AACGAGACAGAAAATTAACAAGG 0: 347
1: 2932
2: 4851
3: 2861
4: 1774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949846363 Original CRISPR TGTCTAATATTGACAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr