ID: 949847120

View in Genome Browser
Species Human (GRCh38)
Location 3:8383039-8383061
Sequence CTGTAGCAGGAGTGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949847115_949847120 12 Left 949847115 3:8383004-8383026 CCTGATGTAATGGCAGTGGCACT No data
Right 949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG No data
949847112_949847120 24 Left 949847112 3:8382992-8383014 CCTCAAAGAACTCCTGATGTAAT No data
Right 949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG No data
949847111_949847120 25 Left 949847111 3:8382991-8383013 CCCTCAAAGAACTCCTGATGTAA No data
Right 949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949847120 Original CRISPR CTGTAGCAGGAGTGGCAGAG AGG Intergenic
No off target data available for this crispr