ID: 949852616

View in Genome Browser
Species Human (GRCh38)
Location 3:8434157-8434179
Sequence GAGAAAAATAAGAAAACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949852613_949852616 3 Left 949852613 3:8434131-8434153 CCTGTGACAATCCTCATTTTACT No data
Right 949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG No data
949852614_949852616 -8 Left 949852614 3:8434142-8434164 CCTCATTTTACTAATGAGAAAAA No data
Right 949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG No data
949852612_949852616 17 Left 949852612 3:8434117-8434139 CCTATCATATAGGTCCTGTGACA No data
Right 949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949852616 Original CRISPR GAGAAAAATAAGAAAACTGA GGG Intergenic
No off target data available for this crispr