ID: 949858702

View in Genome Browser
Species Human (GRCh38)
Location 3:8485950-8485972
Sequence ACCCACTATCTATAATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949858702_949858705 17 Left 949858702 3:8485950-8485972 CCACTATATTATAGATAGTGGGT No data
Right 949858705 3:8485990-8486012 TCAACTCATTCTGGTTTGCCTGG No data
949858702_949858706 18 Left 949858702 3:8485950-8485972 CCACTATATTATAGATAGTGGGT No data
Right 949858706 3:8485991-8486013 CAACTCATTCTGGTTTGCCTGGG No data
949858702_949858703 8 Left 949858702 3:8485950-8485972 CCACTATATTATAGATAGTGGGT No data
Right 949858703 3:8485981-8486003 GTGACCAATTCAACTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949858702 Original CRISPR ACCCACTATCTATAATATAG TGG (reversed) Intergenic
No off target data available for this crispr