ID: 949859835

View in Genome Browser
Species Human (GRCh38)
Location 3:8494940-8494962
Sequence TAGGTTAAGTAAGCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949859835_949859840 29 Left 949859835 3:8494940-8494962 CCTGGAACAGCTTACTTAACCTA No data
Right 949859840 3:8494992-8495014 GGAATAACACACTTGCCCCTGGG No data
949859835_949859839 28 Left 949859835 3:8494940-8494962 CCTGGAACAGCTTACTTAACCTA No data
Right 949859839 3:8494991-8495013 AGGAATAACACACTTGCCCCTGG No data
949859835_949859841 30 Left 949859835 3:8494940-8494962 CCTGGAACAGCTTACTTAACCTA No data
Right 949859841 3:8494993-8495015 GAATAACACACTTGCCCCTGGGG No data
949859835_949859838 8 Left 949859835 3:8494940-8494962 CCTGGAACAGCTTACTTAACCTA No data
Right 949859838 3:8494971-8494993 TCAGTTTCTCATCTGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949859835 Original CRISPR TAGGTTAAGTAAGCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr