ID: 949860982

View in Genome Browser
Species Human (GRCh38)
Location 3:8504504-8504526
Sequence TTTATGACTTTCCAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949860982_949860985 14 Left 949860982 3:8504504-8504526 CCCACCAACTGGAAAGTCATAAA 0: 1
1: 0
2: 1
3: 16
4: 333
Right 949860985 3:8504541-8504563 AGAACATAAAATCTAAAAACTGG 0: 1
1: 0
2: 5
3: 83
4: 878
949860982_949860986 28 Left 949860982 3:8504504-8504526 CCCACCAACTGGAAAGTCATAAA 0: 1
1: 0
2: 1
3: 16
4: 333
Right 949860986 3:8504555-8504577 AAAAACTGGAGTAGACTTAAAGG 0: 1
1: 0
2: 0
3: 27
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949860982 Original CRISPR TTTATGACTTTCCAGTTGGT GGG (reversed) Intronic
902134038 1:14289515-14289537 TTTTTTACTTTCCATTTGCTTGG + Intergenic
905262997 1:36732304-36732326 TTTATGGCATTCCTGATGGTGGG + Intergenic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
905843645 1:41207350-41207372 TTTTTCACTTTCCATTTGCTTGG - Intronic
906894132 1:49752899-49752921 TTTCTGGCTTTCCATTTGCTTGG + Intronic
908611218 1:65863833-65863855 TTTTTGGCTTTCCATTTGCTTGG + Intronic
910272952 1:85417094-85417116 TTGATCATTTTACAGTTGGTGGG - Intronic
910550201 1:88466795-88466817 TTTATGGTTTTCCAGTTAGAGGG - Intergenic
910635473 1:89403300-89403322 TTTTTCACTTTCCATTTGCTTGG + Intergenic
911166481 1:94729054-94729076 TCTATGACCTTCCACTTTGTTGG + Intergenic
912676143 1:111682487-111682509 TTTTTGGCTTTCCATTTGCTTGG - Intronic
912765812 1:112409515-112409537 TTTATTTCTTTCCAGGTGGTAGG - Intronic
913362920 1:118002656-118002678 TTTTTGTCTTTCCATTTGCTTGG + Intronic
913399640 1:118415883-118415905 TTTATTTCTTTCTACTTGGTTGG - Intergenic
914730499 1:150365288-150365310 TTTCTGGCTTTCCTGATGGTAGG + Intronic
915716061 1:157946362-157946384 TTTCTGACATTCCTGTTGGTGGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
918814539 1:189166111-189166133 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
920349777 1:205330057-205330079 TTGATGGGTTTCCAGGTGGTTGG - Intergenic
921255142 1:213332158-213332180 TTTACTACATTTCAGTTGGTTGG - Intergenic
922066447 1:222148082-222148104 TTTTTGGCTTTCCATTTGTTTGG - Intergenic
922232083 1:223696313-223696335 TTTCTCAGTTTGCAGTTGGTTGG - Intergenic
922738492 1:228002688-228002710 TTTTTGACTTTGCAGGGGGTTGG - Intergenic
923943302 1:238854032-238854054 TTTTTTGCTTTCCAGTTGCTTGG + Intergenic
924002609 1:239570553-239570575 TTTATGAATGGCCAGTTTGTTGG + Intronic
924950236 1:248875370-248875392 TCTGTGACTTTCAAGTTGGGGGG - Intergenic
1063591108 10:7396354-7396376 TTTAAGACTTTTCTGTTAGTTGG + Intronic
1064572081 10:16704209-16704231 ATGATGATTCTCCAGTTGGTAGG - Intronic
1065422248 10:25558242-25558264 TTTATAAGTTTAAAGTTGGTTGG - Intronic
1066749811 10:38642890-38642912 TTTATGTCTTGCCAGTTCCTGGG + Intergenic
1066966837 10:42274886-42274908 TTTATGTCTTGCCAGTTCCTGGG - Intergenic
1067326123 10:45268110-45268132 TTTTTCACTTTCCATTTGCTTGG - Intergenic
1067335658 10:45361048-45361070 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1067784069 10:49229735-49229757 TTTATGACTTGCCCATTGGCTGG - Intergenic
1068085859 10:52373061-52373083 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1069300550 10:66901687-66901709 TTTTTGGCTTTCCATTTGCTTGG - Intronic
1072358721 10:94638180-94638202 TTTTTTACTTTCCATTTGCTTGG + Intergenic
1074636106 10:115319722-115319744 TTTTTAACTTTCCATTTGCTTGG + Intronic
1074657409 10:115608949-115608971 TTTTTAAATTTCCAGTTGTTTGG + Intronic
1077945889 11:6898057-6898079 TTTATGACTTGTCAGATGCTAGG + Intergenic
1078743183 11:14087961-14087983 TTTTTGGCTTTCCATTTGCTTGG + Intronic
1079529428 11:21432219-21432241 TTTTTGACTTTTCAGCTGTTTGG + Intronic
1080710285 11:34740089-34740111 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1081094724 11:38919161-38919183 TTTTTTACTTTCCATTTGCTTGG + Intergenic
1081425114 11:42917868-42917890 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1081469229 11:43354103-43354125 TTTATTATTTTTCAGTTTGTTGG - Intergenic
1082127598 11:48451641-48451663 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1082198181 11:49328473-49328495 TTAATGAAATTCCAGTTGCTCGG - Intergenic
1082561155 11:54622570-54622592 TTTTTGGCTTTCCATTTGGTTGG + Intergenic
1083327717 11:61881641-61881663 TTTAAGACTCACCAGCTGGTAGG - Intronic
1085800929 11:79588400-79588422 TTTTTTGCTTTCCATTTGGTTGG - Intergenic
1086031184 11:82357793-82357815 TTTTTGTGTTTCCAGTTGGTAGG - Intergenic
1086349110 11:85926895-85926917 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1086538279 11:87876578-87876600 TCTAGGACTTTGGAGTTGGTGGG + Intergenic
1086657632 11:89379674-89379696 TTAATGAAATTCCAGTTGCTCGG + Intronic
1088004436 11:104924030-104924052 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1088138681 11:106589308-106589330 TTTATGGCTATACATTTGGTTGG - Intergenic
1088534710 11:110848141-110848163 TTTATTGCTTTCCATTTGCTTGG + Intergenic
1088563314 11:111138229-111138251 TTTATAACTTTCTAGCTGGATGG + Intergenic
1094060840 12:26314151-26314173 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1094195698 12:27747552-27747574 TTTATGATTTTCAAATTGCTTGG + Intronic
1094482117 12:30892865-30892887 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1094730197 12:33165591-33165613 TTTTTCACTTTCCATTTGCTTGG - Intergenic
1095831252 12:46589510-46589532 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1096361122 12:50988199-50988221 TTTATGACTCAACCGTTGGTTGG - Exonic
1096876839 12:54636053-54636075 TTTGTGACTTTCCCCTTGCTTGG + Intergenic
1097642877 12:62203665-62203687 TTTTTGGCTTTCCATTTGCTTGG + Intronic
1097656405 12:62368638-62368660 TTTCTTGCTTTCCATTTGGTTGG + Intronic
1097978719 12:65715248-65715270 TTTATGCCTTTCCATTTCCTTGG + Intergenic
1099548894 12:84018494-84018516 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1100458083 12:94772186-94772208 ATTGTCTCTTTCCAGTTGGTAGG - Intergenic
1102620080 12:114187385-114187407 TTTAAAAATTTCCAGTTGTTAGG + Intergenic
1103070023 12:117933667-117933689 TTTATGACTTTGCTGTTTATCGG - Intronic
1104100226 12:125600778-125600800 TTTATTTCTTTCCATTTGCTTGG - Intronic
1105645561 13:22314272-22314294 TTTTTGGCTTTCCATTTGTTTGG + Intergenic
1106992803 13:35442656-35442678 TTTATGAATTTCCCGTTTGTTGG + Intronic
1107570828 13:41656517-41656539 TATGAGACTTTCCAGTTGCTGGG - Intronic
1107749087 13:43545296-43545318 TTTATCACTTTGAAGATGGTAGG - Intronic
1107991277 13:45820837-45820859 TTACTGACTTTCCAGTTTCTAGG + Intronic
1108867701 13:54941744-54941766 TTTATGACTTTGCAGTGGCATGG + Intergenic
1108873060 13:55010163-55010185 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1110199485 13:72832097-72832119 TTTTTTGCTTTCCATTTGGTTGG + Intronic
1110374417 13:74776194-74776216 TTTAGGAATTTCTAGTTGATAGG - Intergenic
1111599168 13:90449271-90449293 TTTCTGTCTTTCCAGCTGGAAGG + Intergenic
1111779222 13:92700271-92700293 TTTTTGGCTTTCCATTTGCTTGG + Intronic
1113830938 13:113295507-113295529 TTTATGTCTTTCCACAGGGTGGG + Intergenic
1115007957 14:28509612-28509634 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1115610222 14:35041841-35041863 TTCTTGACATTCCACTTGGTAGG + Intergenic
1116143291 14:41029757-41029779 ATTATTAGTTTTCAGTTGGTGGG - Intergenic
1116318113 14:43424166-43424188 TTTTTCACTTTCCATTTGCTTGG - Intergenic
1116565640 14:46440788-46440810 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1117849832 14:59956468-59956490 TTTTTTACTTTCCATTTGCTTGG + Intronic
1118530918 14:66703946-66703968 TTTTTGGCTTTCCATTTGCTTGG - Intronic
1119102943 14:71896853-71896875 TTTATGAGTTACCATTGGGTAGG + Intergenic
1119567507 14:75641167-75641189 TTTATGCCTTTCCAGGTATTTGG + Exonic
1119785307 14:77308936-77308958 TTTATCCCTCTTCAGTTGGTGGG - Intronic
1120581078 14:86249904-86249926 TTTATGAATATCCAGATGTTTGG - Intergenic
1120678147 14:87446874-87446896 TTTATTACTTTATATTTGGTAGG - Intergenic
1124885883 15:33685256-33685278 TTTATTGCTTTCCATTTGCTCGG - Intronic
1126742301 15:51789170-51789192 TTTTTTACTTTCCATTTGCTTGG - Intronic
1127253642 15:57269387-57269409 TTTTTGGCTTTCCATTTGTTTGG + Intronic
1127559119 15:60118322-60118344 TTTGTGACTTTCCAGTATTTAGG - Intergenic
1127630602 15:60823967-60823989 TTTATGGCCTTCAAGTTTGTTGG + Intronic
1128525977 15:68412554-68412576 TTTCTCTCTTTCCAGTTGCTAGG + Intronic
1128833983 15:70794495-70794517 TTTCTGGCTTTCCTCTTGGTGGG + Intergenic
1128933928 15:71729627-71729649 TTTTAGACTGTCCAGTTGGTTGG + Intronic
1132096662 15:98990272-98990294 TTTTTTTCTTTCCATTTGGTTGG - Intronic
1133378216 16:5307149-5307171 CTTATTACATTTCAGTTGGTGGG + Intergenic
1135077086 16:19403021-19403043 TTTGTGACTTTGCAGCTGGGAGG - Intergenic
1148686012 17:49501712-49501734 TTCATGACATCCCTGTTGGTAGG + Intronic
1149174682 17:53855075-53855097 TTTTTTGCTTTCCATTTGGTTGG - Intergenic
1149224621 17:54454728-54454750 TTTATAACTTACCAGTTTGCTGG - Intergenic
1149241936 17:54661351-54661373 TTTTTTACTTTCCATTTGCTTGG + Intergenic
1149281041 17:55106292-55106314 TTTTTTACTTTCCATTTGCTTGG + Intronic
1149885962 17:60340500-60340522 TTTTTGGCTTTCCATTTGCTTGG + Intronic
1151984124 17:77531125-77531147 CTCATGTGTTTCCAGTTGGTTGG + Intergenic
1152050384 17:77970193-77970215 TATTTGGCTTTCCAGTTGGAAGG + Intergenic
1153942546 18:9990494-9990516 TTTATGTCTTCTCAGTTTGTAGG + Intergenic
1155009201 18:21758262-21758284 TTTGTGACCTGCCAGCTGGTTGG - Intronic
1156230511 18:35150027-35150049 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1156608571 18:38698449-38698471 TTTATGACTCTTTATTTGGTTGG - Intergenic
1157173060 18:45425825-45425847 TTTATGACTTTCCCATGGATAGG + Intronic
1158398800 18:57102285-57102307 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1158411116 18:57206767-57206789 TGTATGACTTTCCTGGTAGTTGG + Intergenic
1160068922 18:75607462-75607484 TTTATGAGTTTCCAGTTTCCAGG - Intergenic
1162295011 19:9807415-9807437 TCTCTGCCTTTCCAGTTGGAAGG - Intergenic
1165970164 19:39622232-39622254 TTTTTTGCTTTCCAGTTGCTTGG + Intergenic
1166023948 19:40062060-40062082 TTTATTAGTATACAGTTGGTAGG + Intergenic
1168209344 19:54878762-54878784 TTTTTGGCTTTCCATTTGCTTGG + Intronic
926258694 2:11235936-11235958 TTTATGCCTTTCAAGATGATAGG - Exonic
926448103 2:12969295-12969317 TTTATGACAATCCAGTTGGATGG + Intergenic
926553850 2:14333424-14333446 TTTTTGCCTTTTCAGGTGGTAGG - Intergenic
927571309 2:24163140-24163162 TTTATGACTTTCTAGGAGATCGG + Intronic
929243290 2:39674856-39674878 TTTCTGAAATTCAAGTTGGTAGG + Intronic
929298779 2:40277643-40277665 TTTATGACATTTCAGATGCTGGG - Intronic
930114721 2:47708785-47708807 TCTCTGCTTTTCCAGTTGGTTGG - Intronic
930830234 2:55734993-55735015 TTTCTGACTTTCTATTTGGAAGG - Intergenic
931907364 2:66857092-66857114 TTTTTTACTTTCCATTTGCTTGG + Intergenic
932511558 2:72298316-72298338 TTTTTAACTTTCCATTTGCTTGG + Intronic
932525884 2:72467520-72467542 TATATGACTTTCCACCTGTTAGG - Intronic
933355866 2:81208297-81208319 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
935506648 2:103912771-103912793 TTTCTTACTTTCCATTTGCTTGG - Intergenic
936910096 2:117581545-117581567 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
937143388 2:119620903-119620925 TTTTTAACTTTCCATTTGCTGGG - Intronic
937738221 2:125316956-125316978 GAGATGACTTTCCAGTTGATTGG + Intergenic
937824328 2:126349312-126349334 TTTATAACTTTGCTGTTGCTTGG - Intergenic
938874183 2:135516114-135516136 TTTTTGGCTTTCCATTTGCTTGG + Intronic
939876460 2:147584273-147584295 TTTATTGCTTTCCATTTGCTTGG + Intergenic
939942297 2:148364652-148364674 TTTATTGCTTTCCATTTGCTTGG - Intronic
939947162 2:148423861-148423883 TTTATTGCTTTCCATTTGCTTGG - Intronic
940203630 2:151178171-151178193 TTTATGACTTTACAGTTGGACGG - Intergenic
940302940 2:152194586-152194608 TTTTTAACTTTCCATTTGCTTGG - Intergenic
940471046 2:154100769-154100791 TTTGTCTCTTTCCAGTTCGTAGG + Intronic
940821629 2:158361979-158362001 TTTTTGGCTTTCCATTTGCTTGG - Intronic
942576750 2:177372031-177372053 TTTTTTACTTTCCATTTGTTTGG + Intronic
942939445 2:181598899-181598921 TTTTTGAATTTCCTATTGGTTGG - Intronic
943047581 2:182876783-182876805 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
943415211 2:187593215-187593237 TTTCTGATTCTCCAGTTTGTAGG - Intergenic
943859197 2:192837864-192837886 GTTATGCTTTTCCATTTGGTTGG - Intergenic
943970984 2:194405802-194405824 TTTATTGCTTTCCATTTGCTTGG - Intergenic
944275357 2:197831329-197831351 TTTTTTCCTTTCCATTTGGTTGG - Intronic
944487849 2:200225343-200225365 TTGATGACTTTCCAGCTTCTTGG + Intergenic
945329501 2:208523391-208523413 TTTTTTACTTTCCATTTGCTTGG + Intronic
945927650 2:215821637-215821659 TTTATTGCTTTCCATTTGCTTGG - Intergenic
946435200 2:219647027-219647049 TTTATAACTGTACAGTTAGTAGG + Intergenic
947887615 2:233586478-233586500 TGTATGTCTATACAGTTGGTTGG + Intergenic
1169538729 20:6576794-6576816 TTTATCACTCTCCGGTTGATGGG + Intergenic
1169685348 20:8265384-8265406 TTTAAGACTTGCCAATGGGTGGG + Intronic
1170283296 20:14675859-14675881 TTTTTGGCTTTCCATTTGTTTGG - Intronic
1173080893 20:39866346-39866368 GTTATGGCTTTCCACTTTGTCGG - Intergenic
1173189808 20:40867492-40867514 TATATCACTGTCCAGTTGCTAGG + Intergenic
1173962687 20:47087360-47087382 TTTCTCACTTTACAGTTGCTTGG - Intronic
1175032594 20:55970571-55970593 TCTATTACTTTCCAGCTGGGTGG + Intergenic
1175071666 20:56339076-56339098 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1176631382 21:9141820-9141842 TTTGTTACTTTCCACTTGCTTGG + Intergenic
1177136617 21:17310963-17310985 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1178756160 21:35352045-35352067 TTTATGAGTCTCCGGTTGGTTGG - Intronic
1183113450 22:35670168-35670190 TTTGTAACTTTCCAGTTTGCTGG - Intergenic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
949979296 3:9490920-9490942 TCTATGCCTTTCCAGTTGACAGG - Intergenic
950840556 3:15964372-15964394 TTTATTACTTAACTGTTGGTTGG + Intergenic
951361045 3:21724460-21724482 TTTTTGGCTTTCCATTTGCTTGG - Intronic
952023833 3:29055445-29055467 TTTATTGCTTTCCACTTGCTTGG + Intergenic
953304084 3:41810403-41810425 TTTAAAACTTTCCAGGTGGGTGG + Intronic
954490374 3:50899307-50899329 TTTTTCACTTTCCATTTGCTTGG + Intronic
954572152 3:51650096-51650118 TTTTTTACTTTCCATTTGCTTGG - Intronic
956477187 3:69635169-69635191 TTTTTTACTTTCCATTTGCTTGG + Intergenic
956647080 3:71466744-71466766 TTTGTGACCTTCCCGATGGTCGG - Intronic
957463192 3:80549962-80549984 TTTATTACTTTCCTGTTTGTAGG - Intergenic
957561702 3:81830381-81830403 TTTATGACTATCAACATGGTAGG - Intergenic
958191548 3:90191488-90191510 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
958763333 3:98334593-98334615 TTTATGACTTTCTAGAATGTTGG + Intergenic
958849147 3:99302816-99302838 TTTTTCACTTTCCATTTGCTTGG - Intergenic
959281928 3:104353250-104353272 TCTACAACTTTTCAGTTGGTTGG - Intergenic
959354455 3:105308131-105308153 TTTTTGACTTTCCATTTGCTTGG + Intergenic
959492919 3:107013189-107013211 TTTTTAATTTTCCATTTGGTTGG - Intergenic
959622462 3:108412939-108412961 TTTTTTACTTTCAAATTGGTGGG - Intronic
962239205 3:133736614-133736636 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
962835178 3:139183512-139183534 TTTAGGCCTTTCCAGTTGAAAGG - Intronic
963306051 3:143654473-143654495 TTTTAGACGTTGCAGTTGGTGGG + Intronic
964937289 3:162105827-162105849 CTTTTGAATTTCCAGTTGGCAGG - Intergenic
966624239 3:181999471-181999493 TTAATCACTTTCCAGGTGGAGGG + Intergenic
969453331 4:7287182-7287204 TCTGGGATTTTCCAGTTGGTCGG - Intronic
970288158 4:14541238-14541260 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
970975482 4:22038684-22038706 TTTTTTACTTTCCATTTGCTTGG + Intergenic
971033144 4:22662993-22663015 CTTTTGACTTTCCATTTTGTAGG + Intergenic
971676271 4:29633559-29633581 TTAATGACTATCCAGTTAGATGG - Intergenic
973070009 4:45846626-45846648 TTTATGACTCTCAAGTTGATTGG + Intergenic
974670536 4:65024462-65024484 TTAATGCCTTTGCTGTTGGTGGG - Intergenic
977052432 4:92146070-92146092 TTTTTGGCTTTCCATTTGGATGG - Intergenic
978090537 4:104709179-104709201 TTTCTTGCTTTCCATTTGGTTGG - Intergenic
978231888 4:106409763-106409785 TTTATGACTTTTCAGTGGCATGG - Intergenic
978654207 4:111047644-111047666 TTTATGGCTTTCCATGTGATTGG - Intergenic
979017246 4:115450518-115450540 TTTATTGCTTTCCATTTGCTCGG + Intergenic
979170468 4:117595588-117595610 TTTGTTACTTACCAGTTGCTGGG + Intergenic
980593800 4:134926845-134926867 TTTATTGCTTTCCATTTGTTTGG + Intergenic
981411491 4:144437239-144437261 TTTTTTACTTTCCATTTGCTTGG - Intergenic
981823335 4:148911634-148911656 TTTTTGACCATCCAGTGGGTTGG + Intergenic
982494837 4:156077678-156077700 TTTCTCACTTTCCGTTTGGTGGG + Intergenic
982852724 4:160340305-160340327 TTTATTGCTTTCCATTTGTTTGG + Intergenic
983263345 4:165481051-165481073 TTTATTATTTTTCATTTGGTTGG - Intronic
983673994 4:170270496-170270518 TTTTTGACTTTCAATTAGGTGGG + Intergenic
983821198 4:172195108-172195130 TTTTTGGCTTTCCATTTGCTTGG - Intronic
983899216 4:173115188-173115210 TTTCTGTCTTTCCATTTGCTTGG - Intergenic
984618886 4:181929337-181929359 TTTTTGCCTTTCCATTTGCTTGG - Intergenic
985213181 4:187617726-187617748 TTTCTGTCTTTCAAGTTGGATGG - Intergenic
985554340 5:549295-549317 TTTATGACTCTTCACTTGCTGGG - Intergenic
986480891 5:8186495-8186517 TTTGTGACTTACCCGTTGCTCGG + Intergenic
986833847 5:11612066-11612088 TTTGTGACTTTCCATTACGTAGG - Intronic
986855778 5:11867115-11867137 TTCTTGACTATCCAGCTGGTTGG + Intronic
986872461 5:12065664-12065686 TTTATGTCCCTCAAGTTGGTAGG + Intergenic
987180123 5:15358427-15358449 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
987232887 5:15913123-15913145 TTTATGAGTTTACATTTGTTTGG + Intronic
987687828 5:21227571-21227593 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
988203969 5:28110415-28110437 TTTTTGTCTTTCCATTTGCTTGG + Intergenic
988253060 5:28785566-28785588 TTTAAGACTATACAGTTGTTTGG + Intergenic
988290041 5:29272637-29272659 TTTTTTACTTTCCATTTGCTTGG - Intergenic
988627784 5:32896705-32896727 TTTTTAACTTTCCATTTGCTTGG + Intergenic
989083844 5:37654778-37654800 TTTTTGGCTTTCCATTTGCTTGG + Intronic
989802555 5:45561932-45561954 TTTAAGACTTTGCATTTGGCTGG + Intronic
991025481 5:62025094-62025116 TTTTTTGCTTTCCAGTTGCTTGG + Intergenic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
992526007 5:77610966-77610988 TTTTTTGCTTTCCAGTTGCTTGG - Intronic
993587100 5:89745049-89745071 TTTTTTACTTTCCATTTGCTTGG + Intergenic
993829504 5:92737456-92737478 TTTTTTGCTTTCCAGTTGCTTGG + Intergenic
994028232 5:95110041-95110063 TTTATAAATACCCAGTTGGTGGG + Intronic
994356420 5:98798603-98798625 TTTATTACATTGCAGTTGGCAGG - Intronic
995340694 5:111055941-111055963 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
996014616 5:118519319-118519341 TTTATGACATTCTACTTGGCTGG - Intergenic
996055005 5:118973093-118973115 TTTTTGGCTTTCCATTTGCTTGG + Intronic
996686446 5:126286766-126286788 TGTATGAGTTTCCAGTTGTCTGG - Intergenic
1000175012 5:158743469-158743491 TTTAAGATTTTCCAGATCGTAGG + Intronic
1004430541 6:15538535-15538557 TTTATCAGCTTCCAGTTTGTAGG - Intronic
1005770215 6:29062406-29062428 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1006873991 6:37279554-37279576 TTTATGACCTTGTAGTTGGCAGG - Exonic
1007280152 6:40706284-40706306 ATTATGCCCTTCCAGCTGGTAGG - Intergenic
1009193853 6:60661782-60661804 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1010477215 6:76302832-76302854 TTTTTTGCTTTCCAGTTGCTTGG + Intergenic
1010500858 6:76598158-76598180 ATTCTAACTTTCCAGATGGTAGG + Intergenic
1012480641 6:99663354-99663376 TGTATGACTTTCCATTTGAAAGG - Intergenic
1014807841 6:125851063-125851085 TTTATGAGTCTCCAATTGTTTGG + Intronic
1014938380 6:127410765-127410787 TTTTTTACTTTCCATTTGCTTGG + Intergenic
1015610084 6:135007777-135007799 TGAATGAATTTCCAGTTGTTTGG - Intronic
1016436654 6:144045014-144045036 TTTTTGGCTTTCCATTTGCTTGG + Intronic
1016589818 6:145731841-145731863 TTTATCACTTGGCACTTGGTTGG - Intronic
1016638412 6:146321795-146321817 TTTATTGCTTTCCATTTGCTTGG + Intronic
1016870463 6:148811195-148811217 GTTATGACTCCCCAGCTGGTTGG + Intronic
1017970080 6:159304429-159304451 TTTAATATCTTCCAGTTGGTGGG - Intergenic
1018053701 6:160033687-160033709 TTAATGAGTTTACAGTTGATAGG + Intronic
1020633562 7:10670268-10670290 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1020982755 7:15092384-15092406 TTTATTACTCTCAAGTTAGTTGG + Intergenic
1021464440 7:20926187-20926209 TTTTTGACTTTCCATTTGCTTGG + Intergenic
1022064161 7:26833532-26833554 TTTATTGCTTTCCATTTGCTTGG - Intronic
1022739330 7:33106648-33106670 TTTAGGAATATACAGTTGGTGGG + Intronic
1022840565 7:34160405-34160427 TTTATTTCCTTCCAGTTGTTCGG - Intergenic
1023511384 7:40957468-40957490 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1023565461 7:41520318-41520340 TTTGTGACATTGCTGTTGGTTGG + Intergenic
1024129863 7:46340140-46340162 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1024619954 7:51148655-51148677 GATATGCATTTCCAGTTGGTAGG - Intronic
1025097263 7:56106139-56106161 GTTATGCCTTTCCCGTTGTTTGG + Intronic
1026163436 7:67889856-67889878 TTCATCACTTTCCAGATGGTCGG - Intergenic
1028080537 7:86569485-86569507 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1028119230 7:87039142-87039164 TTTTAGGTTTTCCAGTTGGTTGG - Intronic
1029028852 7:97447798-97447820 TTTATTATTTTCCTGTTGATGGG - Intergenic
1030166209 7:106558288-106558310 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1030330429 7:108264532-108264554 TTTCTGAAATTCCAGTTTGTTGG - Intronic
1030689770 7:112520306-112520328 TTAATGACAATCCAGATGGTGGG - Intergenic
1030703329 7:112665812-112665834 TTTGTGACTTTCCACTTAATTGG + Intergenic
1031106969 7:117555926-117555948 TTTTTGACTATACAGTGGGTTGG + Intronic
1031591045 7:123593102-123593124 TTTTTTACTTTCCATTTGTTTGG + Intronic
1031640103 7:124152488-124152510 TGTCTTACTTTCTAGTTGGTAGG + Intergenic
1032874696 7:136025168-136025190 TCTATGACTTACTAGCTGGTTGG + Intergenic
1033492956 7:141862448-141862470 TTTAGGACCTTCCAGGTGGAAGG + Intergenic
1033495110 7:141886403-141886425 TTTAGGACCTTCCAGGTGGAAGG + Intergenic
1034714871 7:153232835-153232857 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1036052782 8:5218559-5218581 TTCATGACTTTCCATGTGGAAGG - Intergenic
1040519856 8:48167187-48167209 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1040540887 8:48354013-48354035 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1040992923 8:53371295-53371317 TTTTTCATTTTCCATTTGGTTGG - Intergenic
1041602433 8:59735797-59735819 TTTATTACTTTCCATTTGTTAGG + Intergenic
1042326881 8:67538528-67538550 TTTTTTGCTTTCCATTTGGTTGG + Intronic
1042833678 8:73058064-73058086 TTTTTGCCTTTCCATTTGCTTGG - Intergenic
1044267971 8:90205465-90205487 TTTATTGCTTTCCATTTGCTTGG - Intergenic
1044940015 8:97332974-97332996 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1044961239 8:97532483-97532505 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1046710639 8:117507093-117507115 TTAATGACTTTCAAGTTGTCTGG + Intergenic
1047311150 8:123693185-123693207 TTTATGACTTACAATTTGATAGG + Exonic
1049436044 8:142586742-142586764 TCTGTGAGGTTCCAGTTGGTGGG - Intergenic
1050200973 9:3145732-3145754 TTTATTGCTTTCCATTTGCTTGG + Intergenic
1051095344 9:13459641-13459663 TTTATGACATGCCAGCTGCTTGG + Intergenic
1051951663 9:22642184-22642206 TGTATGACTTTCAATTTTGTTGG - Intergenic
1052580762 9:30350666-30350688 TTCTTTACTTTTCAGTTGGTGGG - Intergenic
1053429323 9:38031776-38031798 TTTATGACTTTGCATTTGGAAGG - Intronic
1055661764 9:78511108-78511130 TTTAGGTCTTTCCTGTGGGTAGG + Intergenic
1056075664 9:83036298-83036320 TGGCTGACTTTCCAGGTGGTTGG - Intronic
1056233845 9:84572423-84572445 TATATGATTTTCCATTTGGCTGG - Intergenic
1056732941 9:89181591-89181613 TTTATTATCTTCCAGTTTGTAGG + Intergenic
1059158960 9:112015705-112015727 TTCATCACTTACCAGTTGGGTGG - Intergenic
1059797927 9:117719745-117719767 CTTAGGACTTTCCAGATGGTTGG + Intergenic
1186024503 X:5294335-5294357 GTTATGATTTTCCAAGTGGTTGG - Intergenic
1189213805 X:39306295-39306317 TTTATGACTTCCCAACTGATCGG + Intergenic
1189715033 X:43856512-43856534 TTTTTGACTGTACAGGTGGTTGG - Intronic
1191111786 X:56809586-56809608 TTTTTGGCTTTCCATTTGCTTGG + Intergenic
1191705333 X:64087927-64087949 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1192061533 X:67832230-67832252 TTTTTCACTTTCCATTTGCTTGG - Intergenic
1192654945 X:72983010-72983032 TTTTTTGCTTTCCATTTGGTTGG - Intergenic
1192826136 X:74698019-74698041 TTTTTTACTTTCCATTTGCTTGG - Intergenic
1193059939 X:77195300-77195322 TTTATTGCTTTCCATTTGCTTGG + Intergenic
1193068821 X:77285149-77285171 TTTTTGGCTTTCCATTTGCTTGG - Intergenic
1193174133 X:78372155-78372177 TTTTTTGCTTTCCATTTGGTTGG + Intergenic
1193719280 X:84969488-84969510 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1194146948 X:90277324-90277346 TTGATGACTTTCCATTCGGAGGG + Intergenic
1195979117 X:110559263-110559285 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1196111621 X:111952641-111952663 TTTATGACTTACCAGTTCTGTGG + Intronic
1196946349 X:120830891-120830913 TTTTTCACTTTCCATTTGCTTGG + Intergenic
1197800724 X:130345045-130345067 TTTGTGTCATTCCACTTGGTGGG + Intronic
1198041321 X:132855662-132855684 TTTACAAATTTCTAGTTGGTGGG - Intronic
1198085874 X:133281250-133281272 TTTTTGGCTTTCCATTTGTTTGG - Intergenic
1198595690 X:138233025-138233047 TTTCTTACTTTCCATTTGCTTGG - Intergenic
1199589510 X:149453869-149453891 TTTATGGCTCTCCACATGGTAGG + Intergenic
1199796428 X:151202131-151202153 TTTTTAGCTTTCCAGTTGCTTGG - Intergenic
1200687184 Y:6267088-6267110 TTTCTGCCTTTCCAGTTGAGAGG + Intergenic
1200881022 Y:8211241-8211263 ATTATGTCTTTCTAATTGGTGGG + Intergenic
1201048093 Y:9907622-9907644 TTTCTGCCTTTCCAGTTGAGAGG - Intergenic
1201180752 Y:11342507-11342529 TTTATGTCTTGCCAGTTTCTGGG + Intergenic
1201366916 Y:13216970-13216992 TTTATGACTATAAAGTTGATGGG + Intergenic
1201580370 Y:15505069-15505091 TTTTTGGCTTTCCATTTGTTTGG - Intergenic
1201854241 Y:18523294-18523316 TTTTTAACTTTCCATTTGCTTGG - Intergenic
1201879080 Y:18797090-18797112 TTTTTAACTTTCCATTTGCTTGG + Intronic
1201922401 Y:19247557-19247579 TTTTTGGCTTTCCATTTGCTTGG - Intergenic